Incidental Mutation 'R7339:Prom1'
ID 569696
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Name prominin 1
Synonyms 4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 43993620-44102032 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 44101653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000196178] [ENSMUST00000197750]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074113
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087441
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196178
SMART Domains Protein: ENSMUSP00000143403
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 98 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197750
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
BB001:Prom1 UTSW 5 44029769 missense probably benign 0.03
BB011:Prom1 UTSW 5 44029769 missense probably benign 0.03
R1018:Prom1 UTSW 5 44029714 missense probably benign 0.02
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1536:Prom1 UTSW 5 44018353 missense probably benign 0.39
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2022:Prom1 UTSW 5 44029726 missense probably benign 0.18
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4909:Prom1 UTSW 5 44045552 missense probably benign 0.00
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 splice site probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5537:Prom1 UTSW 5 44000776 critical splice donor site probably null
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6542:Prom1 UTSW 5 44037509 missense possibly damaging 0.84
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
R7158:Prom1 UTSW 5 44012913 missense probably damaging 1.00
R7233:Prom1 UTSW 5 44037474 missense possibly damaging 0.90
R7244:Prom1 UTSW 5 44020900 missense probably benign 0.03
R7365:Prom1 UTSW 5 44020831 missense probably damaging 1.00
R7573:Prom1 UTSW 5 44055930 missense probably damaging 0.99
R7592:Prom1 UTSW 5 44063127 missense probably damaging 0.96
R7809:Prom1 UTSW 5 44020867 missense probably benign 0.10
R7915:Prom1 UTSW 5 44004935 missense possibly damaging 0.88
R7924:Prom1 UTSW 5 44029769 missense probably benign 0.03
R8122:Prom1 UTSW 5 44012953 missense probably benign 0.12
R8187:Prom1 UTSW 5 44034366 missense probably damaging 1.00
R8195:Prom1 UTSW 5 44037428 missense possibly damaging 0.69
R8516:Prom1 UTSW 5 44007099 missense probably benign 0.05
R8529:Prom1 UTSW 5 44013027 splice site probably null
R8670:Prom1 UTSW 5 44001844 missense probably benign 0.00
R8835:Prom1 UTSW 5 44018380 missense probably damaging 1.00
R8907:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R9017:Prom1 UTSW 5 44047528 missense probably damaging 1.00
R9104:Prom1 UTSW 5 44014819 missense probably benign 0.02
R9173:Prom1 UTSW 5 44063178 missense possibly damaging 0.94
R9361:Prom1 UTSW 5 44055887 missense probably damaging 0.99
R9519:Prom1 UTSW 5 44056061 missense possibly damaging 0.61
R9574:Prom1 UTSW 5 44000837 missense probably benign 0.01
R9604:Prom1 UTSW 5 44029733 missense probably damaging 0.99
R9615:Prom1 UTSW 5 44007057 missense probably damaging 1.00
R9680:Prom1 UTSW 5 44032942 critical splice donor site probably null
Z1177:Prom1 UTSW 5 44014838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGCACGCTCTATAACCAGTCC -3'
(R):5'- AACAGGTTCCCAGAGTCCTG -3'

Sequencing Primer
(F):5'- CGCTCTATAACCAGTCCTCCAG -3'
(R):5'- AGAGTCCTGGAGTCCCGTG -3'
Posted On 2019-09-13