Incidental Mutation 'R7339:2900026A02Rik'
ID 569698
Institutional Source Beutler Lab
Gene Symbol 2900026A02Rik
Ensembl Gene ENSMUSG00000051339
Gene Name RIKEN cDNA 2900026A02 gene
Synonyms LOC231620, Gm449
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113086323-113221236 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113183072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1092 (D1092G)
Ref Sequence ENSEMBL: ENSMUSP00000147419 (fasta)
AlphaFold Q8BRV5
Predicted Effect probably benign
Transcript: ENSMUST00000211733
AA Change: D1092G

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in 2900026A02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02810:2900026A02Rik APN 5 113101535 missense probably damaging 1.00
R1394:2900026A02Rik UTSW 5 113101496 missense probably damaging 1.00
R1395:2900026A02Rik UTSW 5 113101496 missense probably damaging 1.00
R4329:2900026A02Rik UTSW 5 113095589 critical splice donor site probably null
R4766:2900026A02Rik UTSW 5 113097636 missense probably benign 0.01
R6124:2900026A02Rik UTSW 5 113183756 missense probably benign
R6336:2900026A02Rik UTSW 5 113183483 missense possibly damaging 0.88
R6365:2900026A02Rik UTSW 5 113182644 missense probably benign 0.00
R6575:2900026A02Rik UTSW 5 113182817 missense probably damaging 1.00
R6759:2900026A02Rik UTSW 5 113183826 missense probably benign 0.00
R7117:2900026A02Rik UTSW 5 113191384 missense probably benign 0.00
R7168:2900026A02Rik UTSW 5 113137793 missense probably damaging 0.96
R7450:2900026A02Rik UTSW 5 113184111 missense possibly damaging 0.78
R7458:2900026A02Rik UTSW 5 113190644 missense probably benign 0.05
R7525:2900026A02Rik UTSW 5 113183355 missense probably damaging 0.99
R7707:2900026A02Rik UTSW 5 113137986 start codon destroyed probably benign 0.14
R7848:2900026A02Rik UTSW 5 113192141 missense probably damaging 0.96
R7869:2900026A02Rik UTSW 5 113184135 missense possibly damaging 0.47
R7871:2900026A02Rik UTSW 5 113183226 missense probably benign 0.02
R8327:2900026A02Rik UTSW 5 113183819 missense possibly damaging 0.94
R8411:2900026A02Rik UTSW 5 113137722 missense probably benign
R8429:2900026A02Rik UTSW 5 113183436 missense probably benign 0.29
R8940:2900026A02Rik UTSW 5 113093202 missense probably benign 0.07
R9065:2900026A02Rik UTSW 5 113175218 missense probably benign 0.00
R9096:2900026A02Rik UTSW 5 113191927 missense
R9182:2900026A02Rik UTSW 5 113095607 missense probably damaging 1.00
R9191:2900026A02Rik UTSW 5 113182698 missense probably benign 0.34
R9330:2900026A02Rik UTSW 5 113182967 missense probably benign 0.14
R9336:2900026A02Rik UTSW 5 113093100 critical splice donor site probably null
R9375:2900026A02Rik UTSW 5 113184701 missense probably benign
R9388:2900026A02Rik UTSW 5 113190848 missense probably benign 0.00
R9483:2900026A02Rik UTSW 5 113191144 missense probably benign 0.01
R9529:2900026A02Rik UTSW 5 113183816 missense possibly damaging 0.61
R9675:2900026A02Rik UTSW 5 113191961 missense probably damaging 1.00
R9784:2900026A02Rik UTSW 5 113190661 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTCCCTGGGAACGTTTCAC -3'
(R):5'- GCGGTGACTTATCAGGTTCC -3'

Sequencing Primer
(F):5'- CCTGGGAACGTTTCACTAACC -3'
(R):5'- GGACTGAAGATATGTTGGAACCTTC -3'
Posted On 2019-09-13