Incidental Mutation 'R7339:Slc35b4'
ID569700
Institutional Source Beutler Lab
Gene Symbol Slc35b4
Ensembl Gene ENSMUSG00000018999
Gene Namesolute carrier family 35, member B4
Synonyms4930474D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7339 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location34153380-34177111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34167656 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 88 (I88T)
Ref Sequence ENSEMBL: ENSMUSP00000019143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019143] [ENSMUST00000138250]
Predicted Effect probably damaging
Transcript: ENSMUST00000019143
AA Change: I88T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019143
Gene: ENSMUSG00000018999
AA Change: I88T

DomainStartEndE-ValueType
Pfam:UAA 2 314 1.7e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138250
Meta Mutation Damage Score 0.9069 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyltransferases, such as SLC35B4, transport nucleotide sugars from the cytoplasm where they are synthesized, to the Golgi apparatus where they are utilized in the synthesis of glycoproteins, glycolipids, and proteoglycans (Ashikov et al., 2005 [PubMed 15911612]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Slc35b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Slc35b4 APN 6 34158429 missense probably benign 0.03
IGL01667:Slc35b4 APN 6 34167675 missense possibly damaging 0.81
IGL01670:Slc35b4 APN 6 34170549 missense probably benign 0.00
IGL02015:Slc35b4 APN 6 34170548 missense probably damaging 1.00
IGL02710:Slc35b4 APN 6 34158541 missense probably benign 0.02
IGL03051:Slc35b4 APN 6 34160471 critical splice donor site probably null
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R1052:Slc35b4 UTSW 6 34161684 missense probably damaging 1.00
R1304:Slc35b4 UTSW 6 34163365 nonsense probably null
R1606:Slc35b4 UTSW 6 34158388 nonsense probably null
R1713:Slc35b4 UTSW 6 34170549 missense probably benign 0.00
R1872:Slc35b4 UTSW 6 34158505 nonsense probably null
R5539:Slc35b4 UTSW 6 34176802 missense probably damaging 0.99
R6954:Slc35b4 UTSW 6 34158621 missense probably benign 0.02
R7560:Slc35b4 UTSW 6 34163361 missense probably benign 0.01
R8189:Slc35b4 UTSW 6 34167635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTTCTGGGAACACTCG -3'
(R):5'- TGGCTCAGACTTTCCCCATG -3'

Sequencing Primer
(F):5'- TGGGACAAGCCTGTAATCCCAG -3'
(R):5'- CCATGCTAGTCTGACTTTGTCAAGG -3'
Posted On2019-09-13