Incidental Mutation 'R7339:Nlrp2'
ID 569702
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
MMRRC Submission 045429-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5330627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 590 (I590F)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect possibly damaging
Transcript: ENSMUST00000045022
AA Change: I590F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: I590F

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,330,938 (GRCm39) D1092G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Ahnak A T 19: 8,985,529 (GRCm39) N2271I possibly damaging Het
Amz1 A G 5: 140,727,306 (GRCm39) S90G probably benign Het
Arhgap5 A G 12: 52,564,481 (GRCm39) E484G possibly damaging Het
Arid3c A G 4: 41,729,883 (GRCm39) probably null Het
Atp1a1 T C 3: 101,497,188 (GRCm39) I373V probably benign Het
Barhl1 T C 2: 28,799,899 (GRCm39) E242G probably damaging Het
Bltp2 G A 11: 78,163,210 (GRCm39) probably null Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Casz1 T A 4: 149,036,202 (GRCm39) V1488E probably damaging Het
Ccdc175 C A 12: 72,182,815 (GRCm39) Q401H probably damaging Het
Cfap36 T C 11: 29,175,925 (GRCm39) Y191C probably benign Het
Chmp2b G A 16: 65,342,232 (GRCm39) Q119* probably null Het
Cps1 T A 1: 67,236,174 (GRCm39) I969N possibly damaging Het
Dennd5a A G 7: 109,500,366 (GRCm39) F920L probably damaging Het
Dnah12 A T 14: 26,594,277 (GRCm39) T3410S probably benign Het
Fbxo42 T G 4: 140,927,455 (GRCm39) S578R possibly damaging Het
Fcgr1 C T 3: 96,191,615 (GRCm39) G398R not run Het
Foxa3 A T 7: 18,748,794 (GRCm39) Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 (GRCm39) K190E probably benign Het
Gbp10 T C 5: 105,367,964 (GRCm39) Y403C possibly damaging Het
Hsd3b5 A G 3: 98,529,390 (GRCm39) I80T probably damaging Het
Kri1 T G 9: 21,197,883 (GRCm39) Q89P Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Metap1 T C 3: 138,171,898 (GRCm39) probably null Het
Mkrn3 C T 7: 62,069,530 (GRCm39) R87H probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myh6 T C 14: 55,199,025 (GRCm39) probably null Het
Naip6 G T 13: 100,452,527 (GRCm39) P178Q probably damaging Het
Ncapg2 A G 12: 116,378,454 (GRCm39) E160G probably damaging Het
Nek6 G A 2: 38,450,977 (GRCm39) A127T probably damaging Het
Nell1 T C 7: 49,929,297 (GRCm39) V264A probably benign Het
Or13j1 C T 4: 43,706,080 (GRCm39) A163T probably benign Het
Or2y17 G A 11: 49,231,875 (GRCm39) R172Q not run Het
Or4f57 A T 2: 111,790,956 (GRCm39) M154K probably benign Het
Or4f6 A G 2: 111,838,820 (GRCm39) L237P probably damaging Het
Or52n4b A C 7: 108,144,107 (GRCm39) D125A probably damaging Het
Otop3 T A 11: 115,237,204 (GRCm39) L556Q probably damaging Het
Padi1 T C 4: 140,556,545 (GRCm39) D190G probably null Het
Pald1 T C 10: 61,159,110 (GRCm39) S774G possibly damaging Het
Pde10a C T 17: 8,975,860 (GRCm39) T55I probably benign Het
Pla2g4d T C 2: 120,109,459 (GRCm39) M197V probably benign Het
Prom1 C A 5: 44,258,995 (GRCm39) probably benign Het
Ptdss1 A G 13: 67,111,426 (GRCm39) H164R possibly damaging Het
Rrh A T 3: 129,604,262 (GRCm39) I313N probably damaging Het
Slc35b4 A G 6: 34,144,591 (GRCm39) I88T probably damaging Het
Slc38a11 C T 2: 65,156,914 (GRCm39) V353I probably benign Het
Spata31e3 A T 13: 50,401,204 (GRCm39) I374N possibly damaging Het
Spdef T A 17: 27,939,219 (GRCm39) E42D probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmx1 A G 12: 70,505,624 (GRCm39) D129G probably benign Het
Trav13n-4 A T 14: 53,601,435 (GRCm39) Y68F probably benign Het
Trp53 T C 11: 69,480,015 (GRCm39) S238P probably damaging Het
Trp53bp1 T C 2: 121,066,950 (GRCm39) D592G probably benign Het
Ttll5 T C 12: 85,904,238 (GRCm39) probably null Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,306 (GRCm39) Y302* probably null Het
Vps13d C T 4: 144,847,938 (GRCm39) V2478I Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Wsb1 A G 11: 79,131,184 (GRCm39) V404A probably damaging Het
Zfc3h1 A G 10: 115,239,205 (GRCm39) D539G probably damaging Het
Zfp318 T C 17: 46,722,173 (GRCm39) V1392A probably damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5,311,769 (GRCm39) missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5,330,614 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6173:Nlrp2 UTSW 7 5,340,808 (GRCm39) missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5,330,548 (GRCm39) missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGCAACATTCTCTGGAAAG -3'
(R):5'- GAACATGCTTTCAAGGGAAGC -3'

Sequencing Primer
(F):5'- TGGAAAGACCGCCTTTTCTAC -3'
(R):5'- AGACTACTTTTGGCTGCC -3'
Posted On 2019-09-13