Mutagenetix > Incidental Mutation

Incidental Mutation 'R7339:Nlrp2'

569702

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7339 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 5327628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 590 (I590F)

Ref Sequence

ENSEMBL: ENSMUSP00000045077 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022]

AlphaFold

Q4PLS0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045022
AA Change: I590F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: I590F

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	A	11: 78,272,384		probably null	Het
2900026A02Rik	T	C	5: 113,183,072	D1092G	probably benign	Het
9030624J02Rik	A	T	7: 118,809,971	I612F	probably damaging	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Ahnak	A	T	19: 9,008,165	N2271I	possibly damaging	Het
Amz1	A	G	5: 140,741,551	S90G	probably benign	Het
Arhgap5	A	G	12: 52,517,698	E484G	possibly damaging	Het
Arid3c	A	G	4: 41,729,883		probably null	Het
Atp1a1	T	C	3: 101,589,872	I373V	probably benign	Het
Barhl1	T	C	2: 28,909,887	E242G	probably damaging	Het
Cactin	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	10: 81,321,318		probably benign	Het
Casz1	T	A	4: 148,951,745	V1488E	probably damaging	Het
Ccdc175	C	A	12: 72,136,041	Q401H	probably damaging	Het
Cfap36	T	C	11: 29,225,925	Y191C	probably benign	Het
Chmp2b	G	A	16: 65,545,346	Q119*	probably null	Het
Cps1	T	A	1: 67,197,015	I969N	possibly damaging	Het
Dennd5a	A	G	7: 109,901,159	F920L	probably damaging	Het
Dnah12	A	T	14: 26,872,320	T3410S	probably benign	Het
Fbxo42	T	G	4: 141,200,144	S578R	possibly damaging	Het
Fcgr1	C	T	3: 96,284,299	G398R	not run	Het
Foxa3	A	T	7: 19,014,869	Y111N	probably damaging	Het
Gabbr2	T	C	4: 46,846,340	K190E	probably benign	Het
Gbp10	T	C	5: 105,220,098	Y403C	possibly damaging	Het
Gm906	A	T	13: 50,247,168	I374N	possibly damaging	Het
Hsd3b5	A	G	3: 98,622,074	I80T	probably damaging	Het
Kri1	T	G	9: 21,286,587	Q89P		Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Metap1	T	C	3: 138,466,137		probably null	Het
Mkrn3	C	T	7: 62,419,782	R87H	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myh6	T	C	14: 54,961,568		probably null	Het
Naip6	G	T	13: 100,316,019	P178Q	probably damaging	Het
Ncapg2	A	G	12: 116,414,834	E160G	probably damaging	Het
Nek6	G	A	2: 38,560,965	A127T	probably damaging	Het
Nell1	T	C	7: 50,279,549	V264A	probably benign	Het
Olfr1308	A	T	2: 111,960,611	M154K	probably benign	Het
Olfr1310	A	G	2: 112,008,475	L237P	probably damaging	Het
Olfr1390	G	A	11: 49,341,048	R172Q	not run	Het
Olfr503	A	C	7: 108,544,900	D125A	probably damaging	Het
Olfr71	C	T	4: 43,706,080	A163T	probably benign	Het
Otop3	T	A	11: 115,346,378	L556Q	probably damaging	Het
Padi1	T	C	4: 140,829,234	D190G	probably null	Het
Pald1	T	C	10: 61,323,331	S774G	possibly damaging	Het
Pde10a	C	T	17: 8,757,028	T55I	probably benign	Het
Pla2g4d	T	C	2: 120,278,978	M197V	probably benign	Het
Prom1	C	A	5: 44,101,653		probably benign	Het
Ptdss1	A	G	13: 66,963,362	H164R	possibly damaging	Het
Rrh	A	T	3: 129,810,613	I313N	probably damaging	Het
Slc35b4	A	G	6: 34,167,656	I88T	probably damaging	Het
Slc38a11	C	T	2: 65,326,570	V353I	probably benign	Het
Spdef	T	A	17: 27,720,245	E42D	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmx1	A	G	12: 70,458,850	D129G	probably benign	Het
Trav13n-4	A	T	14: 53,363,978	Y68F	probably benign	Het
Trp53	T	C	11: 69,589,189	S238P	probably damaging	Het
Trp53bp1	T	C	2: 121,236,469	D592G	probably benign	Het
Ttll5	T	C	12: 85,857,464		probably null	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn2r43	A	T	7: 8,255,307	Y302*	probably null	Het
Vps13d	C	T	4: 145,121,368	V2478I		Het
Wsb1	A	G	11: 79,240,358	V404A	probably damaging	Het
Zfc3h1	A	G	10: 115,403,300	D539G	probably damaging	Het
Zfp318	T	C	17: 46,411,247	V1392A	probably damaging	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
R8785:Nlrp2	UTSW	7	5327549	missense	probably damaging	0.99
R8798:Nlrp2	UTSW	7	5327888	missense	possibly damaging	0.86
R8982:Nlrp2	UTSW	7	5324979	missense	probably damaging	1.00
R9030:Nlrp2	UTSW	7	5322458	missense	probably null	0.00
R9038:Nlrp2	UTSW	7	5327479	missense	probably benign	0.14
R9149:Nlrp2	UTSW	7	5327573	missense	probably benign	0.01
R9229:Nlrp2	UTSW	7	5301053	missense	possibly damaging	0.81
R9584:Nlrp2	UTSW	7	5319216	missense	probably damaging	1.00
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCAGCAACATTCTCTGGAAAG -3'
(R):5'- GAACATGCTTTCAAGGGAAGC -3'

Sequencing Primer
(F):5'- TGGAAAGACCGCCTTTTCTAC -3'
(R):5'- AGACTACTTTTGGCTGCC -3'

Posted On

2019-09-13