Incidental Mutation 'R7339:Foxa3'
ID 569704
Institutional Source Beutler Lab
Gene Symbol Foxa3
Ensembl Gene ENSMUSG00000040891
Gene Name forkhead box A3
Synonyms Hnf-3g, Hnf3g, Tcf-3g, Tcf3g
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 19013284-19023538 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19014869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 111 (Y111N)
Ref Sequence ENSEMBL: ENSMUSP00000043173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036018]
AlphaFold P35584
Predicted Effect probably damaging
Transcript: ENSMUST00000036018
AA Change: Y111N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043173
Gene: ENSMUSG00000040891
AA Change: Y111N

DomainStartEndE-ValueType
low complexity region 59 93 N/A INTRINSIC
FH 117 207 5.48e-62 SMART
low complexity region 226 267 N/A INTRINSIC
Pfam:HNF_C 304 332 1.9e-7 PFAM
Meta Mutation Damage Score 0.3889 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. The crystal structure of a similar protein in rat has been resolved. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expression of several liver-specific and liver-enriched genes, but appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Foxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Foxa3 APN 7 19014518 missense probably benign
R0378:Foxa3 UTSW 7 19023369 missense probably damaging 1.00
R1833:Foxa3 UTSW 7 19014574 missense probably damaging 1.00
R2159:Foxa3 UTSW 7 19014184 missense probably benign 0.40
R2877:Foxa3 UTSW 7 19014880 missense probably benign 0.38
R4666:Foxa3 UTSW 7 19014372 nonsense probably null
R5533:Foxa3 UTSW 7 19015015 nonsense probably null
R5669:Foxa3 UTSW 7 19014251 missense probably benign 0.41
R8128:Foxa3 UTSW 7 19023416 start codon destroyed probably null 0.77
R8329:Foxa3 UTSW 7 19014184 missense probably benign 0.40
R9232:Foxa3 UTSW 7 19014865 missense probably damaging 1.00
R9305:Foxa3 UTSW 7 19015036 missense possibly damaging 0.82
R9627:Foxa3 UTSW 7 19014533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAAGGACAGCGAATGCCG -3'
(R):5'- TGACCTTGAACCCACTCAGC -3'

Sequencing Primer
(F):5'- CGAATGCCGGATGGAGTTC -3'
(R):5'- TGAACCCACTCAGCTCTCC -3'
Posted On 2019-09-13