Incidental Mutation 'R7339:Mkrn3'
ID569706
Institutional Source Beutler Lab
Gene Symbol Mkrn3
Ensembl Gene ENSMUSG00000070527
Gene Namemakorin, ring finger protein, 3
SynonymsZfp127, D7H15S9-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7339 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location62417593-62420139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62419782 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 87 (R87H)
Ref Sequence ENSEMBL: ENSMUSP00000091898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094340]
Predicted Effect probably benign
Transcript: ENSMUST00000094340
AA Change: R87H

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091898
Gene: ENSMUSG00000070527
AA Change: R87H

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
ZnF_C3H1 92 118 7.31e-8 SMART
low complexity region 156 172 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
ZnF_C3H1 275 300 3.95e-4 SMART
RING 347 400 5.14e-7 SMART
low complexity region 415 422 N/A INTRINSIC
ZnF_C3H1 432 458 1.16e-1 SMART
Pfam:MKRN1_C 467 542 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING (C3HC4) zinc finger motif and several C3H zinc finger motifs. This gene is intronless and imprinted, with expression only from the paternal allele. Disruption of the imprinting at this locus may contribute to Prader-Willi syndrome. An antisense RNA of unknown function has been found overlapping this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Mkrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Mkrn3 UTSW 7 62418864 missense probably benign 0.29
R1885:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R1886:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R2904:Mkrn3 UTSW 7 62418459 missense probably benign 0.38
R3117:Mkrn3 UTSW 7 62419214 small deletion probably benign
R3118:Mkrn3 UTSW 7 62419214 small deletion probably benign
R4593:Mkrn3 UTSW 7 62418804 nonsense probably null
R4654:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R4735:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R5528:Mkrn3 UTSW 7 62418987 missense possibly damaging 0.95
R5932:Mkrn3 UTSW 7 62418907 missense probably damaging 1.00
R5950:Mkrn3 UTSW 7 62419719 missense probably damaging 1.00
R6120:Mkrn3 UTSW 7 62419534 missense probably benign 0.00
R6618:Mkrn3 UTSW 7 62419033 missense probably benign 0.25
R6951:Mkrn3 UTSW 7 62419133 missense possibly damaging 0.68
R7009:Mkrn3 UTSW 7 62419618 missense probably benign 0.05
R7227:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7228:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7286:Mkrn3 UTSW 7 62418927 missense probably benign 0.15
R8268:Mkrn3 UTSW 7 62418522 missense probably damaging 1.00
R8366:Mkrn3 UTSW 7 62419795 missense probably benign 0.21
X0025:Mkrn3 UTSW 7 62419773 missense probably damaging 1.00
Z1176:Mkrn3 UTSW 7 62419810 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTCAGCAGCCGAGCCAATC -3'
(R):5'- GAGTCTACAGCTCCCATTGAGG -3'

Sequencing Primer
(F):5'- CAGCCGAGCCAATCAGAGG -3'
(R):5'- AGGGTGTGTCTGTTCCCCC -3'
Posted On2019-09-13