Incidental Mutation 'R7339:Pald1'
ID 569711
Institutional Source Beutler Lab
Gene Symbol Pald1
Ensembl Gene ENSMUSG00000020092
Gene Name phosphatase domain containing, paladin 1
Synonyms paladin, X99384
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 61319656-61383530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61323331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 774 (S774G)
Ref Sequence ENSEMBL: ENSMUSP00000020289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020289]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000020289
AA Change: S774G

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020289
Gene: ENSMUSG00000020092
AA Change: S774G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
PTPlike_phytase 164 333 4.33e-53 SMART
low complexity region 428 441 N/A INTRINSIC
PTPlike_phytase 548 682 5.37e-49 SMART
low complexity region 757 768 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Pald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Pald1 APN 10 61347141 splice site probably benign
IGL03068:Pald1 APN 10 61321184 missense possibly damaging 0.94
IGL03106:Pald1 APN 10 61347105 missense probably benign 0.41
R0331:Pald1 UTSW 10 61340929 critical splice donor site probably null
R0497:Pald1 UTSW 10 61341315 missense probably damaging 0.99
R1181:Pald1 UTSW 10 61347587 splice site probably benign
R1437:Pald1 UTSW 10 61341285 missense possibly damaging 0.63
R1466:Pald1 UTSW 10 61348525 splice site probably benign
R1827:Pald1 UTSW 10 61355922 small deletion probably benign
R2129:Pald1 UTSW 10 61348306 critical splice donor site probably null
R2184:Pald1 UTSW 10 61347136 missense possibly damaging 0.46
R2260:Pald1 UTSW 10 61352971 missense probably damaging 1.00
R3051:Pald1 UTSW 10 61346763 nonsense probably null
R3690:Pald1 UTSW 10 61355808 splice site probably null
R3713:Pald1 UTSW 10 61342365 missense possibly damaging 0.67
R3876:Pald1 UTSW 10 61347487 missense probably damaging 0.97
R4261:Pald1 UTSW 10 61343692 missense probably damaging 1.00
R4600:Pald1 UTSW 10 61348616 missense probably benign 0.00
R4603:Pald1 UTSW 10 61348616 missense probably benign 0.00
R5069:Pald1 UTSW 10 61341246 missense possibly damaging 0.50
R5354:Pald1 UTSW 10 61348661 missense probably damaging 1.00
R5590:Pald1 UTSW 10 61343710 missense probably damaging 1.00
R5705:Pald1 UTSW 10 61323297 missense possibly damaging 0.90
R5780:Pald1 UTSW 10 61339218 missense probably damaging 1.00
R6239:Pald1 UTSW 10 61321131 missense possibly damaging 0.59
R6380:Pald1 UTSW 10 61350935 missense possibly damaging 0.86
R6812:Pald1 UTSW 10 61342922 missense possibly damaging 0.53
R6891:Pald1 UTSW 10 61348532 critical splice donor site probably null
R6949:Pald1 UTSW 10 61321217 missense probably benign 0.23
R7038:Pald1 UTSW 10 61339299 missense probably benign
R7051:Pald1 UTSW 10 61323346 missense probably benign 0.26
R7188:Pald1 UTSW 10 61347066 missense probably damaging 0.99
R7831:Pald1 UTSW 10 61355814 missense probably damaging 1.00
R8000:Pald1 UTSW 10 61347439 missense probably benign 0.00
R8710:Pald1 UTSW 10 61347453 missense probably benign 0.03
R8903:Pald1 UTSW 10 61347036 critical splice donor site probably null
R9255:Pald1 UTSW 10 61341210 critical splice donor site probably null
R9414:Pald1 UTSW 10 61343153 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTGGCCTTATGAGCTC -3'
(R):5'- TAGGAACTGGGTTTGAGACTCC -3'

Sequencing Primer
(F):5'- GGCCTTATGAGCTCACCAC -3'
(R):5'- CTCTGTGTCCAGGCTAGGCAAC -3'
Posted On 2019-09-13