Incidental Mutation 'R7339:Zfc3h1'
ID 569713
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Name zinc finger, C3H1-type containing
Synonyms Ccdc131, Psrc2
MMRRC Submission 045429-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 115220864-115268677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115239205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 539 (D539G)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
AlphaFold B2RT41
Predicted Effect probably damaging
Transcript: ENSMUST00000036044
AA Change: D539G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: D539G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,330,938 (GRCm39) D1092G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Ahnak A T 19: 8,985,529 (GRCm39) N2271I possibly damaging Het
Amz1 A G 5: 140,727,306 (GRCm39) S90G probably benign Het
Arhgap5 A G 12: 52,564,481 (GRCm39) E484G possibly damaging Het
Arid3c A G 4: 41,729,883 (GRCm39) probably null Het
Atp1a1 T C 3: 101,497,188 (GRCm39) I373V probably benign Het
Barhl1 T C 2: 28,799,899 (GRCm39) E242G probably damaging Het
Bltp2 G A 11: 78,163,210 (GRCm39) probably null Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Casz1 T A 4: 149,036,202 (GRCm39) V1488E probably damaging Het
Ccdc175 C A 12: 72,182,815 (GRCm39) Q401H probably damaging Het
Cfap36 T C 11: 29,175,925 (GRCm39) Y191C probably benign Het
Chmp2b G A 16: 65,342,232 (GRCm39) Q119* probably null Het
Cps1 T A 1: 67,236,174 (GRCm39) I969N possibly damaging Het
Dennd5a A G 7: 109,500,366 (GRCm39) F920L probably damaging Het
Dnah12 A T 14: 26,594,277 (GRCm39) T3410S probably benign Het
Fbxo42 T G 4: 140,927,455 (GRCm39) S578R possibly damaging Het
Fcgr1 C T 3: 96,191,615 (GRCm39) G398R not run Het
Foxa3 A T 7: 18,748,794 (GRCm39) Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 (GRCm39) K190E probably benign Het
Gbp10 T C 5: 105,367,964 (GRCm39) Y403C possibly damaging Het
Hsd3b5 A G 3: 98,529,390 (GRCm39) I80T probably damaging Het
Kri1 T G 9: 21,197,883 (GRCm39) Q89P Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Metap1 T C 3: 138,171,898 (GRCm39) probably null Het
Mkrn3 C T 7: 62,069,530 (GRCm39) R87H probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myh6 T C 14: 55,199,025 (GRCm39) probably null Het
Naip6 G T 13: 100,452,527 (GRCm39) P178Q probably damaging Het
Ncapg2 A G 12: 116,378,454 (GRCm39) E160G probably damaging Het
Nek6 G A 2: 38,450,977 (GRCm39) A127T probably damaging Het
Nell1 T C 7: 49,929,297 (GRCm39) V264A probably benign Het
Nlrp2 T A 7: 5,330,627 (GRCm39) I590F possibly damaging Het
Or13j1 C T 4: 43,706,080 (GRCm39) A163T probably benign Het
Or2y17 G A 11: 49,231,875 (GRCm39) R172Q not run Het
Or4f57 A T 2: 111,790,956 (GRCm39) M154K probably benign Het
Or4f6 A G 2: 111,838,820 (GRCm39) L237P probably damaging Het
Or52n4b A C 7: 108,144,107 (GRCm39) D125A probably damaging Het
Otop3 T A 11: 115,237,204 (GRCm39) L556Q probably damaging Het
Padi1 T C 4: 140,556,545 (GRCm39) D190G probably null Het
Pald1 T C 10: 61,159,110 (GRCm39) S774G possibly damaging Het
Pde10a C T 17: 8,975,860 (GRCm39) T55I probably benign Het
Pla2g4d T C 2: 120,109,459 (GRCm39) M197V probably benign Het
Prom1 C A 5: 44,258,995 (GRCm39) probably benign Het
Ptdss1 A G 13: 67,111,426 (GRCm39) H164R possibly damaging Het
Rrh A T 3: 129,604,262 (GRCm39) I313N probably damaging Het
Slc35b4 A G 6: 34,144,591 (GRCm39) I88T probably damaging Het
Slc38a11 C T 2: 65,156,914 (GRCm39) V353I probably benign Het
Spata31e3 A T 13: 50,401,204 (GRCm39) I374N possibly damaging Het
Spdef T A 17: 27,939,219 (GRCm39) E42D probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmx1 A G 12: 70,505,624 (GRCm39) D129G probably benign Het
Trav13n-4 A T 14: 53,601,435 (GRCm39) Y68F probably benign Het
Trp53 T C 11: 69,480,015 (GRCm39) S238P probably damaging Het
Trp53bp1 T C 2: 121,066,950 (GRCm39) D592G probably benign Het
Ttll5 T C 12: 85,904,238 (GRCm39) probably null Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,306 (GRCm39) Y302* probably null Het
Vps13d C T 4: 144,847,938 (GRCm39) V2478I Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Wsb1 A G 11: 79,131,184 (GRCm39) V404A probably damaging Het
Zfp318 T C 17: 46,722,173 (GRCm39) V1392A probably damaging Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115,255,737 (GRCm39) missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115,252,779 (GRCm39) missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115,259,353 (GRCm39) missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115,259,128 (GRCm39) missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115,263,004 (GRCm39) missense probably benign
IGL02382:Zfc3h1 APN 10 115,252,781 (GRCm39) nonsense probably null
IGL02397:Zfc3h1 APN 10 115,243,890 (GRCm39) missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115,247,859 (GRCm39) missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115,236,809 (GRCm39) missense probably benign 0.42
Gnatcatcher UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
hutton UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
passerine UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R0178_Zfc3h1_655 UTSW 10 115,242,630 (GRCm39) splice site probably benign
vireo UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
warbler UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115,226,794 (GRCm39) missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115,262,944 (GRCm39) nonsense probably null
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115,251,192 (GRCm39) missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115,242,630 (GRCm39) splice site probably benign
R0355:Zfc3h1 UTSW 10 115,245,018 (GRCm39) missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115,256,715 (GRCm39) missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115,246,537 (GRCm39) missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115,237,612 (GRCm39) missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115,263,621 (GRCm39) missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115,247,866 (GRCm39) missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115,248,013 (GRCm39) missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115,252,647 (GRCm39) missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115,226,827 (GRCm39) missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115,242,806 (GRCm39) splice site probably null
R1959:Zfc3h1 UTSW 10 115,259,158 (GRCm39) missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115,246,428 (GRCm39) splice site probably benign
R3691:Zfc3h1 UTSW 10 115,256,595 (GRCm39) missense probably benign
R3909:Zfc3h1 UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115,254,704 (GRCm39) missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115,259,290 (GRCm39) missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115,251,599 (GRCm39) missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115,246,547 (GRCm39) missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115,240,116 (GRCm39) missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5069:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5070:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5155:Zfc3h1 UTSW 10 115,248,026 (GRCm39) missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115,254,597 (GRCm39) missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115,246,598 (GRCm39) missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115,236,815 (GRCm39) missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115,267,262 (GRCm39) intron probably benign
R6165:Zfc3h1 UTSW 10 115,256,574 (GRCm39) missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115,226,764 (GRCm39) missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115,249,881 (GRCm39) missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115,243,813 (GRCm39) missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115,237,653 (GRCm39) missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115,247,907 (GRCm39) missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115,256,638 (GRCm39) missense probably benign 0.34
R7381:Zfc3h1 UTSW 10 115,260,535 (GRCm39) missense probably benign
R7404:Zfc3h1 UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115,246,606 (GRCm39) nonsense probably null
R7748:Zfc3h1 UTSW 10 115,236,720 (GRCm39) missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115,256,588 (GRCm39) nonsense probably null
R7914:Zfc3h1 UTSW 10 115,239,062 (GRCm39) splice site probably null
R8023:Zfc3h1 UTSW 10 115,256,553 (GRCm39) missense probably damaging 1.00
R8169:Zfc3h1 UTSW 10 115,254,616 (GRCm39) missense probably damaging 0.98
R8358:Zfc3h1 UTSW 10 115,240,198 (GRCm39) missense probably benign 0.13
R8746:Zfc3h1 UTSW 10 115,243,885 (GRCm39) missense probably damaging 1.00
R8803:Zfc3h1 UTSW 10 115,247,800 (GRCm39) missense probably benign
R8905:Zfc3h1 UTSW 10 115,259,383 (GRCm39) missense probably benign 0.05
R9045:Zfc3h1 UTSW 10 115,263,319 (GRCm39) missense possibly damaging 0.49
R9164:Zfc3h1 UTSW 10 115,259,374 (GRCm39) missense probably benign 0.17
R9211:Zfc3h1 UTSW 10 115,248,328 (GRCm39) missense possibly damaging 0.83
R9216:Zfc3h1 UTSW 10 115,221,528 (GRCm39) missense unknown
R9305:Zfc3h1 UTSW 10 115,255,771 (GRCm39) missense probably benign 0.19
R9372:Zfc3h1 UTSW 10 115,221,223 (GRCm39) missense unknown
R9394:Zfc3h1 UTSW 10 115,254,600 (GRCm39) missense probably damaging 1.00
R9414:Zfc3h1 UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R9538:Zfc3h1 UTSW 10 115,221,197 (GRCm39) missense unknown
R9623:Zfc3h1 UTSW 10 115,259,362 (GRCm39) missense possibly damaging 0.94
R9633:Zfc3h1 UTSW 10 115,247,852 (GRCm39) missense probably damaging 1.00
R9747:Zfc3h1 UTSW 10 115,244,821 (GRCm39) missense possibly damaging 0.58
Z1176:Zfc3h1 UTSW 10 115,243,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATAGCCATCAACTCTTGGG -3'
(R):5'- GGCTCACAGCTTCAATCCTAG -3'

Sequencing Primer
(F):5'- GCCATCAACTCTTGGGATAAGTAGC -3'
(R):5'- AACTGTCGGTAACTCCAAGGTCTG -3'
Posted On 2019-09-13