Incidental Mutation 'R7339:Wsb1'
ID 569718
Institutional Source Beutler Lab
Gene Symbol Wsb1
Ensembl Gene ENSMUSG00000017677
Gene Name WD repeat and SOCS box-containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 79239372-79254671 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79240358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 404 (V404A)
Ref Sequence ENSEMBL: ENSMUSP00000017821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017821] [ENSMUST00000131848] [ENSMUST00000145772]
AlphaFold O54927
Predicted Effect probably damaging
Transcript: ENSMUST00000017821
AA Change: V404A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017821
Gene: ENSMUSG00000017677
AA Change: V404A

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-16 BLAST
WD40 117 156 8.4e-2 SMART
WD40 159 199 2.5e-10 SMART
WD40 203 242 5.9e-10 SMART
WD40 245 284 2.9e-11 SMART
WD40 300 339 1.2e-5 SMART
WD40 342 379 1.1e-4 SMART
SOCS 378 420 2.7e-18 SMART
SOCS_box 384 420 4.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131818
SMART Domains Protein: ENSMUSP00000131290
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
WD40 48 87 1.33e1 SMART
WD40 90 130 3.72e-8 SMART
WD40 134 172 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131848
SMART Domains Protein: ENSMUSP00000128181
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145772
SMART Domains Protein: ENSMUSP00000137999
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 3e-19 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Wsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Wsb1 APN 11 79242041 missense probably damaging 1.00
IGL02352:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL02359:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL03218:Wsb1 APN 11 79248498 missense probably damaging 0.97
R0488:Wsb1 UTSW 11 79244500 missense probably damaging 1.00
R1051:Wsb1 UTSW 11 79246233 missense probably damaging 1.00
R1612:Wsb1 UTSW 11 79248585 missense probably benign 0.31
R2202:Wsb1 UTSW 11 79240386 missense probably benign
R2449:Wsb1 UTSW 11 79240352 missense probably benign
R4782:Wsb1 UTSW 11 79240373 missense probably benign 0.44
R4805:Wsb1 UTSW 11 79240391 missense possibly damaging 0.95
R4932:Wsb1 UTSW 11 79251000 missense probably damaging 0.96
R5458:Wsb1 UTSW 11 79248436 missense probably damaging 1.00
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6140:Wsb1 UTSW 11 79241618 missense probably damaging 0.98
R6192:Wsb1 UTSW 11 79248510 missense possibly damaging 0.94
R6498:Wsb1 UTSW 11 79248489 missense probably damaging 1.00
R6545:Wsb1 UTSW 11 79251055 missense probably damaging 1.00
R6608:Wsb1 UTSW 11 79240362 missense probably benign 0.30
R7142:Wsb1 UTSW 11 79250988 missense probably benign 0.01
R7361:Wsb1 UTSW 11 79240797 critical splice acceptor site probably null
R8338:Wsb1 UTSW 11 79246277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATTCAATATATAGCAGCAGC -3'
(R):5'- TCTACAGCTGTAGGGACATAGGAC -3'

Sequencing Primer
(F):5'- GCAGCAGCTCATGTCTAAATATATAC -3'
(R):5'- CATAGGACAAGTGTAGTTGTGTAACC -3'
Posted On 2019-09-13