Mutagenetix > Incidental Mutation

Incidental Mutation 'R7339:Arhgap5'

569720

Institutional Source

Beutler Lab

Gene Symbol

Arhgap5

Ensembl Gene

ENSMUSG00000035133

Gene Name

Rho GTPase activating protein 5

Synonyms

p190B, p190-B

MMRRC Submission

Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7339 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52503972-52571975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52517698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 484 (E484G)

Ref Sequence

ENSEMBL: ENSMUSP00000106353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110725
AA Change: E484G

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: E484G

Domain	Start	End	E-Value	Type
Pfam:Ras	142	248	5.3e-7	PFAM
FF	269	325	6.03e-12	SMART
FF	367	420	4.61e-8	SMART
FF	427	482	2.22e-10	SMART
FF	483	537	3.89e-6	SMART
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1224	1247	N/A	INTRINSIC
RhoGAP	1273	1447	1.03e-73	SMART
low complexity region	1479	1496	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217820

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219443
AA Change: E484G

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.2252

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	A	11: 78,272,384		probably null	Het
2900026A02Rik	T	C	5: 113,183,072	D1092G	probably benign	Het
9030624J02Rik	A	T	7: 118,809,971	I612F	probably damaging	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Ahnak	A	T	19: 9,008,165	N2271I	possibly damaging	Het
Amz1	A	G	5: 140,741,551	S90G	probably benign	Het
Arid3c	A	G	4: 41,729,883		probably null	Het
Atp1a1	T	C	3: 101,589,872	I373V	probably benign	Het
Barhl1	T	C	2: 28,909,887	E242G	probably damaging	Het
Cactin	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	10: 81,321,318		probably benign	Het
Casz1	T	A	4: 148,951,745	V1488E	probably damaging	Het
Ccdc175	C	A	12: 72,136,041	Q401H	probably damaging	Het
Cfap36	T	C	11: 29,225,925	Y191C	probably benign	Het
Chmp2b	G	A	16: 65,545,346	Q119*	probably null	Het
Cps1	T	A	1: 67,197,015	I969N	possibly damaging	Het
Dennd5a	A	G	7: 109,901,159	F920L	probably damaging	Het
Dnah12	A	T	14: 26,872,320	T3410S	probably benign	Het
Fbxo42	T	G	4: 141,200,144	S578R	possibly damaging	Het
Fcgr1	C	T	3: 96,284,299	G398R	not run	Het
Foxa3	A	T	7: 19,014,869	Y111N	probably damaging	Het
Gabbr2	T	C	4: 46,846,340	K190E	probably benign	Het
Gbp10	T	C	5: 105,220,098	Y403C	possibly damaging	Het
Gm906	A	T	13: 50,247,168	I374N	possibly damaging	Het
Hsd3b5	A	G	3: 98,622,074	I80T	probably damaging	Het
Kri1	T	G	9: 21,286,587	Q89P		Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Metap1	T	C	3: 138,466,137		probably null	Het
Mkrn3	C	T	7: 62,419,782	R87H	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myh6	T	C	14: 54,961,568		probably null	Het
Naip6	G	T	13: 100,316,019	P178Q	probably damaging	Het
Ncapg2	A	G	12: 116,414,834	E160G	probably damaging	Het
Nek6	G	A	2: 38,560,965	A127T	probably damaging	Het
Nell1	T	C	7: 50,279,549	V264A	probably benign	Het
Nlrp2	T	A	7: 5,327,628	I590F	possibly damaging	Het
Olfr1308	A	T	2: 111,960,611	M154K	probably benign	Het
Olfr1310	A	G	2: 112,008,475	L237P	probably damaging	Het
Olfr1390	G	A	11: 49,341,048	R172Q	not run	Het
Olfr503	A	C	7: 108,544,900	D125A	probably damaging	Het
Olfr71	C	T	4: 43,706,080	A163T	probably benign	Het
Otop3	T	A	11: 115,346,378	L556Q	probably damaging	Het
Padi1	T	C	4: 140,829,234	D190G	probably null	Het
Pald1	T	C	10: 61,323,331	S774G	possibly damaging	Het
Pde10a	C	T	17: 8,757,028	T55I	probably benign	Het
Pla2g4d	T	C	2: 120,278,978	M197V	probably benign	Het
Prom1	C	A	5: 44,101,653		probably benign	Het
Ptdss1	A	G	13: 66,963,362	H164R	possibly damaging	Het
Rrh	A	T	3: 129,810,613	I313N	probably damaging	Het
Slc35b4	A	G	6: 34,167,656	I88T	probably damaging	Het
Slc38a11	C	T	2: 65,326,570	V353I	probably benign	Het
Spdef	T	A	17: 27,720,245	E42D	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmx1	A	G	12: 70,458,850	D129G	probably benign	Het
Trav13n-4	A	T	14: 53,363,978	Y68F	probably benign	Het
Trp53	T	C	11: 69,589,189	S238P	probably damaging	Het
Trp53bp1	T	C	2: 121,236,469	D592G	probably benign	Het
Ttll5	T	C	12: 85,857,464		probably null	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn2r43	A	T	7: 8,255,307	Y302*	probably null	Het
Vps13d	C	T	4: 145,121,368	V2478I		Het
Wsb1	A	G	11: 79,240,358	V404A	probably damaging	Het
Zfc3h1	A	G	10: 115,403,300	D539G	probably damaging	Het
Zfp318	T	C	17: 46,411,247	V1392A	probably damaging	Het

Other mutations in Arhgap5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Arhgap5	APN	12	52517281	missense	probably damaging	0.98
IGL00823:Arhgap5	APN	12	52518742	missense	possibly damaging	0.84
IGL01161:Arhgap5	APN	12	52516860	missense	probably damaging	1.00
IGL01360:Arhgap5	APN	12	52518240	missense	probably damaging	1.00
IGL01910:Arhgap5	APN	12	52516861	missense	probably benign	0.33
IGL02417:Arhgap5	APN	12	52518353	missense	probably damaging	0.99
IGL02448:Arhgap5	APN	12	52562340	missense	probably damaging	0.97
IGL02813:Arhgap5	APN	12	52516965	missense	probably benign	0.20
IGL03398:Arhgap5	APN	12	52517311	missense	probably damaging	0.99
Decline	UTSW	12	52516582	nonsense	probably null
Pass	UTSW	12	52516507	missense	possibly damaging	0.82
3-1:Arhgap5	UTSW	12	52518882	missense	possibly damaging	0.54
R0039:Arhgap5	UTSW	12	52518735	nonsense	probably null
R0088:Arhgap5	UTSW	12	52516548	missense	probably damaging	1.00
R0104:Arhgap5	UTSW	12	52516717	missense	probably damaging	1.00
R0111:Arhgap5	UTSW	12	52559960	splice site	probably benign
R0356:Arhgap5	UTSW	12	52516308	missense	probably damaging	1.00
R0616:Arhgap5	UTSW	12	52517065	missense	possibly damaging	0.79
R0707:Arhgap5	UTSW	12	52518168	missense	probably damaging	1.00
R0718:Arhgap5	UTSW	12	52516507	missense	possibly damaging	0.82
R0849:Arhgap5	UTSW	12	52519623	missense	probably benign	0.01
R0975:Arhgap5	UTSW	12	52517144	missense	possibly damaging	0.61
R1326:Arhgap5	UTSW	12	52518370	missense	possibly damaging	0.80
R1421:Arhgap5	UTSW	12	52516848	missense	probably damaging	1.00
R1422:Arhgap5	UTSW	12	52519514	missense	probably damaging	1.00
R1625:Arhgap5	UTSW	12	52517376	missense	probably benign
R1711:Arhgap5	UTSW	12	52519345	missense	probably damaging	1.00
R1970:Arhgap5	UTSW	12	52542593	missense	probably damaging	1.00
R2004:Arhgap5	UTSW	12	52518034	missense	probably benign	0.05
R2356:Arhgap5	UTSW	12	52519147	missense	probably benign	0.00
R3792:Arhgap5	UTSW	12	52519888	missense	probably benign	0.21
R3808:Arhgap5	UTSW	12	52567187	missense	possibly damaging	0.72
R4458:Arhgap5	UTSW	12	52517957	missense	probably benign
R4703:Arhgap5	UTSW	12	52517583	missense	probably damaging	0.99
R4736:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4737:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4740:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4768:Arhgap5	UTSW	12	52557492	missense	probably damaging	1.00
R4806:Arhgap5	UTSW	12	52518703	missense	probably damaging	0.99
R4817:Arhgap5	UTSW	12	52519209	missense	possibly damaging	0.71
R5586:Arhgap5	UTSW	12	52519912	missense	possibly damaging	0.95
R5681:Arhgap5	UTSW	12	52519779	missense	probably benign	0.21
R5683:Arhgap5	UTSW	12	52519586	missense	probably benign
R5911:Arhgap5	UTSW	12	52518742	missense	possibly damaging	0.84
R6448:Arhgap5	UTSW	12	52517663	missense	probably benign	0.11
R6887:Arhgap5	UTSW	12	52519144	missense	probably benign
R6988:Arhgap5	UTSW	12	52518125	missense	possibly damaging	0.94
R7009:Arhgap5	UTSW	12	52519639	missense	probably benign	0.03
R7013:Arhgap5	UTSW	12	52518326	missense	probably benign	0.05
R7239:Arhgap5	UTSW	12	52517376	missense	probably benign
R7310:Arhgap5	UTSW	12	52542487	critical splice acceptor site	probably null
R7375:Arhgap5	UTSW	12	52516582	nonsense	probably null
R7421:Arhgap5	UTSW	12	52518000	missense	probably benign	0.42
R7442:Arhgap5	UTSW	12	52516956	missense	probably benign	0.25
R7842:Arhgap5	UTSW	12	52518697	missense	possibly damaging	0.78
R8079:Arhgap5	UTSW	12	52567205	missense	probably benign
R8241:Arhgap5	UTSW	12	52518315	missense	probably benign	0.00
R8419:Arhgap5	UTSW	12	52518789	missense	probably damaging	1.00
R9138:Arhgap5	UTSW	12	52562363	missense	probably benign	0.05
X0018:Arhgap5	UTSW	12	52518397	missense	probably damaging	1.00
Z1176:Arhgap5	UTSW	12	52518463	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCTTCTGAGCACTTTAGAAGCAG -3'
(R):5'- AAGAGATTCTCTATCAGGTGCAAG -3'

Sequencing Primer
(F):5'- TCTGAGCACTTTAGAAGCAGAAAAAG -3'
(R):5'- CAGGTGCAAGTTTCTGTAAAGC -3'

Posted On

2019-09-13