Incidental Mutation 'R7339:Pde10a'
ID 569732
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
MMRRC Submission 045429-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 8744204-9205480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8975860 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 55 (T55I)
Ref Sequence ENSEMBL: ENSMUSP00000111389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115715] [ENSMUST00000115722] [ENSMUST00000115724]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000115715
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115722
Predicted Effect probably benign
Transcript: ENSMUST00000115724
AA Change: T55I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: T55I

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Meta Mutation Damage Score 0.0851 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,330,938 (GRCm39) D1092G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Ahnak A T 19: 8,985,529 (GRCm39) N2271I possibly damaging Het
Amz1 A G 5: 140,727,306 (GRCm39) S90G probably benign Het
Arhgap5 A G 12: 52,564,481 (GRCm39) E484G possibly damaging Het
Arid3c A G 4: 41,729,883 (GRCm39) probably null Het
Atp1a1 T C 3: 101,497,188 (GRCm39) I373V probably benign Het
Barhl1 T C 2: 28,799,899 (GRCm39) E242G probably damaging Het
Bltp2 G A 11: 78,163,210 (GRCm39) probably null Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Casz1 T A 4: 149,036,202 (GRCm39) V1488E probably damaging Het
Ccdc175 C A 12: 72,182,815 (GRCm39) Q401H probably damaging Het
Cfap36 T C 11: 29,175,925 (GRCm39) Y191C probably benign Het
Chmp2b G A 16: 65,342,232 (GRCm39) Q119* probably null Het
Cps1 T A 1: 67,236,174 (GRCm39) I969N possibly damaging Het
Dennd5a A G 7: 109,500,366 (GRCm39) F920L probably damaging Het
Dnah12 A T 14: 26,594,277 (GRCm39) T3410S probably benign Het
Fbxo42 T G 4: 140,927,455 (GRCm39) S578R possibly damaging Het
Fcgr1 C T 3: 96,191,615 (GRCm39) G398R not run Het
Foxa3 A T 7: 18,748,794 (GRCm39) Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 (GRCm39) K190E probably benign Het
Gbp10 T C 5: 105,367,964 (GRCm39) Y403C possibly damaging Het
Hsd3b5 A G 3: 98,529,390 (GRCm39) I80T probably damaging Het
Kri1 T G 9: 21,197,883 (GRCm39) Q89P Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Metap1 T C 3: 138,171,898 (GRCm39) probably null Het
Mkrn3 C T 7: 62,069,530 (GRCm39) R87H probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myh6 T C 14: 55,199,025 (GRCm39) probably null Het
Naip6 G T 13: 100,452,527 (GRCm39) P178Q probably damaging Het
Ncapg2 A G 12: 116,378,454 (GRCm39) E160G probably damaging Het
Nek6 G A 2: 38,450,977 (GRCm39) A127T probably damaging Het
Nell1 T C 7: 49,929,297 (GRCm39) V264A probably benign Het
Nlrp2 T A 7: 5,330,627 (GRCm39) I590F possibly damaging Het
Or13j1 C T 4: 43,706,080 (GRCm39) A163T probably benign Het
Or2y17 G A 11: 49,231,875 (GRCm39) R172Q not run Het
Or4f57 A T 2: 111,790,956 (GRCm39) M154K probably benign Het
Or4f6 A G 2: 111,838,820 (GRCm39) L237P probably damaging Het
Or52n4b A C 7: 108,144,107 (GRCm39) D125A probably damaging Het
Otop3 T A 11: 115,237,204 (GRCm39) L556Q probably damaging Het
Padi1 T C 4: 140,556,545 (GRCm39) D190G probably null Het
Pald1 T C 10: 61,159,110 (GRCm39) S774G possibly damaging Het
Pla2g4d T C 2: 120,109,459 (GRCm39) M197V probably benign Het
Prom1 C A 5: 44,258,995 (GRCm39) probably benign Het
Ptdss1 A G 13: 67,111,426 (GRCm39) H164R possibly damaging Het
Rrh A T 3: 129,604,262 (GRCm39) I313N probably damaging Het
Slc35b4 A G 6: 34,144,591 (GRCm39) I88T probably damaging Het
Slc38a11 C T 2: 65,156,914 (GRCm39) V353I probably benign Het
Spata31e3 A T 13: 50,401,204 (GRCm39) I374N possibly damaging Het
Spdef T A 17: 27,939,219 (GRCm39) E42D probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmx1 A G 12: 70,505,624 (GRCm39) D129G probably benign Het
Trav13n-4 A T 14: 53,601,435 (GRCm39) Y68F probably benign Het
Trp53 T C 11: 69,480,015 (GRCm39) S238P probably damaging Het
Trp53bp1 T C 2: 121,066,950 (GRCm39) D592G probably benign Het
Ttll5 T C 12: 85,904,238 (GRCm39) probably null Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,306 (GRCm39) Y302* probably null Het
Vps13d C T 4: 144,847,938 (GRCm39) V2478I Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Wsb1 A G 11: 79,131,184 (GRCm39) V404A probably damaging Het
Zfc3h1 A G 10: 115,239,205 (GRCm39) D539G probably damaging Het
Zfp318 T C 17: 46,722,173 (GRCm39) V1392A probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 9,163,802 (GRCm39) missense probably damaging 1.00
IGL01762:Pde10a APN 17 9,161,750 (GRCm39) missense possibly damaging 0.74
IGL01814:Pde10a APN 17 9,147,939 (GRCm39) start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 9,193,601 (GRCm39) missense probably damaging 1.00
IGL02386:Pde10a APN 17 9,172,636 (GRCm39) missense possibly damaging 0.93
IGL02573:Pde10a APN 17 9,180,722 (GRCm39) missense probably benign 0.38
IGL02583:Pde10a APN 17 9,200,462 (GRCm39) missense probably benign 0.23
IGL02649:Pde10a APN 17 9,172,604 (GRCm39) missense probably damaging 1.00
IGL02992:Pde10a APN 17 9,168,293 (GRCm39) missense probably damaging 0.97
IGL03109:Pde10a APN 17 9,148,046 (GRCm39) critical splice donor site probably null
brautigam UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
Bride UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
buzzed UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
Gracile UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
Nubile UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
thunderball UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R0004:Pde10a UTSW 17 9,200,408 (GRCm39) missense probably benign 0.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0650:Pde10a UTSW 17 9,161,797 (GRCm39) missense probably damaging 1.00
R1173:Pde10a UTSW 17 9,139,378 (GRCm39) splice site probably benign
R1386:Pde10a UTSW 17 9,172,574 (GRCm39) missense probably damaging 1.00
R1458:Pde10a UTSW 17 9,183,540 (GRCm39) missense probably damaging 0.98
R1598:Pde10a UTSW 17 9,147,976 (GRCm39) missense probably damaging 1.00
R1661:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1665:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1883:Pde10a UTSW 17 9,197,776 (GRCm39) missense possibly damaging 0.86
R1960:Pde10a UTSW 17 9,161,750 (GRCm39) missense possibly damaging 0.74
R2005:Pde10a UTSW 17 9,147,923 (GRCm39) critical splice acceptor site probably null
R2071:Pde10a UTSW 17 9,180,827 (GRCm39) missense probably benign 0.22
R2121:Pde10a UTSW 17 9,196,047 (GRCm39) missense probably damaging 1.00
R2376:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R3721:Pde10a UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R3872:Pde10a UTSW 17 8,975,923 (GRCm39) missense possibly damaging 0.92
R4627:Pde10a UTSW 17 9,200,484 (GRCm39) missense probably damaging 1.00
R4652:Pde10a UTSW 17 8,975,885 (GRCm39) missense possibly damaging 0.82
R5107:Pde10a UTSW 17 9,163,802 (GRCm39) missense probably damaging 1.00
R5184:Pde10a UTSW 17 9,195,987 (GRCm39) missense probably damaging 1.00
R5354:Pde10a UTSW 17 9,180,812 (GRCm39) missense probably damaging 0.97
R5735:Pde10a UTSW 17 9,160,024 (GRCm39) missense probably damaging 0.99
R5878:Pde10a UTSW 17 9,168,204 (GRCm39) missense possibly damaging 0.85
R5921:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R6027:Pde10a UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
R6145:Pde10a UTSW 17 9,147,949 (GRCm39) missense probably damaging 1.00
R6279:Pde10a UTSW 17 9,197,789 (GRCm39) missense probably damaging 0.99
R6409:Pde10a UTSW 17 9,168,270 (GRCm39) missense probably damaging 1.00
R6870:Pde10a UTSW 17 9,186,356 (GRCm39) missense possibly damaging 0.56
R6947:Pde10a UTSW 17 9,188,424 (GRCm39) missense probably damaging 1.00
R7072:Pde10a UTSW 17 9,161,858 (GRCm39) missense probably benign 0.40
R7084:Pde10a UTSW 17 9,159,994 (GRCm39) missense probably benign 0.25
R7294:Pde10a UTSW 17 8,975,853 (GRCm39) missense probably benign
R7347:Pde10a UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
R7373:Pde10a UTSW 17 9,161,824 (GRCm39) missense probably benign 0.00
R7481:Pde10a UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
R7833:Pde10a UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
R7923:Pde10a UTSW 17 9,147,964 (GRCm39) missense probably benign 0.40
R8053:Pde10a UTSW 17 9,193,604 (GRCm39) missense probably benign 0.12
R8137:Pde10a UTSW 17 9,193,647 (GRCm39) missense possibly damaging 0.90
R8722:Pde10a UTSW 17 9,163,772 (GRCm39) missense probably benign 0.01
R8918:Pde10a UTSW 17 9,160,063 (GRCm39) missense possibly damaging 0.65
R8973:Pde10a UTSW 17 9,143,071 (GRCm39) missense probably benign
R9113:Pde10a UTSW 17 9,197,782 (GRCm39) missense probably benign
R9163:Pde10a UTSW 17 9,181,791 (GRCm39) missense possibly damaging 0.89
R9275:Pde10a UTSW 17 9,200,488 (GRCm39) makesense probably null
R9563:Pde10a UTSW 17 9,020,710 (GRCm39) missense unknown
R9641:Pde10a UTSW 17 9,197,816 (GRCm39) missense
R9660:Pde10a UTSW 17 9,170,370 (GRCm39) missense probably damaging 0.99
R9670:Pde10a UTSW 17 9,020,272 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTATAGTGTGACCAGACTCCTAG -3'
(R):5'- CAATGTCCTTCCAAGCTACGG -3'

Sequencing Primer
(F):5'- TAGTCACACTATACACACCCTGTAAG -3'
(R):5'- GGGCATCATCCTGGACACTTTG -3'
Posted On 2019-09-13