Incidental Mutation 'R7340:Fmn2'
ID 569742
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Name formin 2
Synonyms
MMRRC Submission 045430-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.816) question?
Stock # R7340 (G1)
Quality Score 214.458
Status Not validated
Chromosome 1
Chromosomal Location 174329391-174650295 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC at 174436769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
AlphaFold Q9JL04
Predicted Effect probably benign
Transcript: ENSMUST00000030039
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000195621
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Adam30 A T 3: 98,069,637 (GRCm39) N490I probably benign Het
Ankrd55 A T 13: 112,492,497 (GRCm39) I223F probably damaging Het
Ano8 T A 8: 71,935,655 (GRCm39) E321V probably damaging Het
Apc2 A G 10: 80,149,316 (GRCm39) K1457E probably benign Het
Asb15 T A 6: 24,558,513 (GRCm39) V38E probably benign Het
Atp4a T C 7: 30,416,155 (GRCm39) S417P possibly damaging Het
AY358078 A G 14: 52,063,716 (GRCm39) N454S probably damaging Het
Cables2 A G 2: 179,903,450 (GRCm39) Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Camsap3 G A 8: 3,637,960 (GRCm39) probably null Het
Ccdc178 A T 18: 22,150,518 (GRCm39) V705E probably benign Het
Ccdc47 T C 11: 106,091,799 (GRCm39) Q472R possibly damaging Het
Ccdc62 A G 5: 124,089,283 (GRCm39) D307G probably damaging Het
Cdcp3 A G 7: 130,879,344 (GRCm39) T1788A unknown Het
Cdh23 A G 10: 60,366,775 (GRCm39) I235T probably benign Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cfap65 T C 1: 74,960,742 (GRCm39) N743D probably benign Het
Cimap1b T A 15: 89,262,610 (GRCm39) T116S probably benign Het
Clec16a A G 16: 10,398,827 (GRCm39) N329S probably null Het
Col25a1 A G 3: 130,340,006 (GRCm39) probably null Het
Daam1 T G 12: 72,035,713 (GRCm39) D969E probably benign Het
Dntt A C 19: 41,047,004 (GRCm39) probably null Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dst T A 1: 34,229,810 (GRCm39) Y2468N probably benign Het
Exosc9 A G 3: 36,615,297 (GRCm39) T262A possibly damaging Het
Exph5 G A 9: 53,288,309 (GRCm39) A1797T probably damaging Het
Fbp2 A T 13: 62,985,061 (GRCm39) Y287N probably damaging Het
Fus T A 7: 127,581,123 (GRCm39) probably null Het
Galnt9 T A 5: 110,762,054 (GRCm39) N397K probably damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gga1 A G 15: 78,775,651 (GRCm39) T369A probably benign Het
Gp1ba T C 11: 70,531,119 (GRCm39) I295T unknown Het
Hk2 T C 6: 82,705,873 (GRCm39) E810G probably benign Het
Igsf10 A G 3: 59,233,189 (GRCm39) V1848A probably damaging Het
Insrr G A 3: 87,721,623 (GRCm39) probably null Het
Ip6k3 T A 17: 27,367,504 (GRCm39) M231L probably benign Het
Itgb8 T C 12: 119,155,939 (GRCm39) N171S probably benign Het
Ldlrad3 T C 2: 101,897,184 (GRCm39) probably null Het
Ltbp1 T A 17: 75,634,223 (GRCm39) C886* probably null Het
Mettl13 T C 1: 162,366,547 (GRCm39) D444G probably benign Het
Mns1 A G 9: 72,356,025 (GRCm39) Y224C probably damaging Het
Mri1 C T 8: 84,983,525 (GRCm39) R122Q probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo5c A C 9: 75,196,423 (GRCm39) K1290Q probably benign Het
Nlrp12 T G 7: 3,281,755 (GRCm39) Q842H possibly damaging Het
Oga G A 19: 45,755,895 (GRCm39) Q583* probably null Het
Or14c44 T C 7: 86,061,957 (GRCm39) L129P possibly damaging Het
Or14j8 T A 17: 38,263,413 (GRCm39) R167S probably benign Het
Or2t1 A T 14: 14,328,401 (GRCm38) T97S possibly damaging Het
Or5d39 T C 2: 87,979,620 (GRCm39) T248A possibly damaging Het
Otoa A G 7: 120,729,288 (GRCm39) T554A probably benign Het
Per1 A G 11: 68,994,008 (GRCm39) D438G probably damaging Het
Phactr3 G A 2: 177,975,854 (GRCm39) R533H probably damaging Het
Phykpl T C 11: 51,490,370 (GRCm39) F417S probably damaging Het
Pole A T 5: 110,482,330 (GRCm39) T2057S probably benign Het
Polq A G 16: 36,881,288 (GRCm39) T1151A probably benign Het
Polr1g T C 7: 19,093,073 (GRCm39) T36A probably benign Het
Rbm26 A T 14: 105,389,976 (GRCm39) V216E possibly damaging Het
Ryk T C 9: 102,775,737 (GRCm39) I449T probably damaging Het
Sap25 A G 5: 137,640,935 (GRCm39) T225A probably benign Het
Sart3 A G 5: 113,882,728 (GRCm39) M864T probably benign Het
Sec31b T C 19: 44,517,161 (GRCm39) S280G probably benign Het
Sema4d A T 13: 51,877,598 (GRCm39) I78N probably damaging Het
Sgip1 G C 4: 102,778,661 (GRCm39) R419S unknown Het
Slc13a3 T C 2: 165,272,210 (GRCm39) I278V probably benign Het
Slc2a5 A G 4: 150,224,439 (GRCm39) D312G probably benign Het
Slc39a2 A T 14: 52,131,660 (GRCm39) Q77L possibly damaging Het
Srbd1 A T 17: 86,443,782 (GRCm39) V148E probably benign Het
Syngr2 A G 11: 117,703,322 (GRCm39) E46G probably damaging Het
Taok1 A G 11: 77,470,643 (GRCm39) V54A possibly damaging Het
Tas2r106 T A 6: 131,655,185 (GRCm39) H222L probably damaging Het
Tcaf3 A G 6: 42,566,848 (GRCm39) I747T probably benign Het
Tmem151b G T 17: 45,856,195 (GRCm39) P415Q probably benign Het
Tmf1 T C 6: 97,145,061 (GRCm39) D659G possibly damaging Het
Tnn G T 1: 159,973,592 (GRCm39) D258E probably damaging Het
Traj33 A G 14: 54,422,862 (GRCm39) I16V unknown Het
Ttll13 G T 7: 79,906,772 (GRCm39) C480F probably damaging Het
Ttn T C 2: 76,714,415 (GRCm39) N8137S unknown Het
Vmn1r85 T C 7: 12,819,073 (GRCm39) N24D probably damaging Het
Wdr81 T C 11: 75,335,525 (GRCm39) Q649R probably null Het
Zan T C 5: 137,382,092 (GRCm39) T5152A unknown Het
Zc3h6 A G 2: 128,835,110 (GRCm39) D82G possibly damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174,330,885 (GRCm39) missense unknown
IGL01085:Fmn2 APN 1 174,523,220 (GRCm39) missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174,329,994 (GRCm39) missense unknown
IGL02095:Fmn2 APN 1 174,330,167 (GRCm39) missense unknown
IGL02330:Fmn2 APN 1 174,437,511 (GRCm39) missense probably benign 0.38
IGL02552:Fmn2 APN 1 174,523,286 (GRCm39) missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174,409,625 (GRCm39) missense unknown
PIT4498001:Fmn2 UTSW 1 174,440,170 (GRCm39) missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174,474,699 (GRCm39) missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174,618,880 (GRCm39) missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0306:Fmn2 UTSW 1 174,437,050 (GRCm39) unclassified probably benign
R0325:Fmn2 UTSW 1 174,437,520 (GRCm39) critical splice donor site probably null
R0403:Fmn2 UTSW 1 174,521,844 (GRCm39) missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174,409,525 (GRCm39) missense unknown
R0898:Fmn2 UTSW 1 174,331,026 (GRCm39) missense unknown
R1202:Fmn2 UTSW 1 174,440,101 (GRCm39) nonsense probably null
R1719:Fmn2 UTSW 1 174,436,024 (GRCm39) unclassified probably benign
R1763:Fmn2 UTSW 1 174,329,832 (GRCm39) missense unknown
R1771:Fmn2 UTSW 1 174,436,342 (GRCm39) unclassified probably benign
R1777:Fmn2 UTSW 1 174,409,488 (GRCm39) missense unknown
R1831:Fmn2 UTSW 1 174,437,511 (GRCm39) missense probably benign 0.38
R2259:Fmn2 UTSW 1 174,330,498 (GRCm39) missense unknown
R2960:Fmn2 UTSW 1 174,437,385 (GRCm39) missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174,330,192 (GRCm39) missense unknown
R3840:Fmn2 UTSW 1 174,409,599 (GRCm39) frame shift probably null
R4207:Fmn2 UTSW 1 174,409,521 (GRCm39) missense unknown
R4679:Fmn2 UTSW 1 174,330,728 (GRCm39) missense unknown
R4779:Fmn2 UTSW 1 174,437,461 (GRCm39) missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174,409,527 (GRCm39) missense unknown
R4926:Fmn2 UTSW 1 174,329,981 (GRCm39) missense unknown
R5007:Fmn2 UTSW 1 174,571,866 (GRCm39) missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174,648,794 (GRCm39) missense probably benign 0.04
R5324:Fmn2 UTSW 1 174,436,446 (GRCm39) unclassified probably benign
R5353:Fmn2 UTSW 1 174,330,572 (GRCm39) missense unknown
R5420:Fmn2 UTSW 1 174,526,344 (GRCm39) nonsense probably null
R5607:Fmn2 UTSW 1 174,437,377 (GRCm39) missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174,409,603 (GRCm39) missense unknown
R5982:Fmn2 UTSW 1 174,330,019 (GRCm39) missense unknown
R6148:Fmn2 UTSW 1 174,494,229 (GRCm39) missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174,440,119 (GRCm39) missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174,437,149 (GRCm39) unclassified probably benign
R6647:Fmn2 UTSW 1 174,420,670 (GRCm39) missense unknown
R6835:Fmn2 UTSW 1 174,527,235 (GRCm39) missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7378:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7457:Fmn2 UTSW 1 174,331,303 (GRCm39) splice site probably null
R7474:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7564:Fmn2 UTSW 1 174,437,140 (GRCm39) missense unknown
R7582:Fmn2 UTSW 1 174,526,356 (GRCm39) missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174,494,215 (GRCm39) missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8035:Fmn2 UTSW 1 174,547,437 (GRCm39) missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8343:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8371:Fmn2 UTSW 1 174,437,173 (GRCm39) missense unknown
R8377:Fmn2 UTSW 1 174,436,011 (GRCm39) nonsense probably null
R8543:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8724:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8726:Fmn2 UTSW 1 174,437,404 (GRCm39) missense possibly damaging 0.86
R8891:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R9074:Fmn2 UTSW 1 174,436,198 (GRCm39) missense unknown
R9167:Fmn2 UTSW 1 174,331,056 (GRCm39) missense unknown
R9489:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9598:Fmn2 UTSW 1 174,436,308 (GRCm39) missense unknown
R9605:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9698:Fmn2 UTSW 1 174,364,739 (GRCm39) missense unknown
RF010:Fmn2 UTSW 1 174,409,581 (GRCm39) missense unknown
Z1176:Fmn2 UTSW 1 174,435,960 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAGTCCTCCAGTTTCATGCCTG -3'
(R):5'- GGTATTCCCACTCCAGGAAGAG -3'

Sequencing Primer
(F):5'- CAGTTTCATGCCTGGCCTGG -3'
(R):5'- GGTATTCCCACTCCAGGAAGAG -3'
Posted On 2019-09-13