Incidental Mutation 'R7340:Tcaf3'
ID 569763
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 045430-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7340 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42566848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 747 (I747T)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: I747T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: I747T

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Adam30 A T 3: 98,069,637 (GRCm39) N490I probably benign Het
Ankrd55 A T 13: 112,492,497 (GRCm39) I223F probably damaging Het
Ano8 T A 8: 71,935,655 (GRCm39) E321V probably damaging Het
Apc2 A G 10: 80,149,316 (GRCm39) K1457E probably benign Het
Asb15 T A 6: 24,558,513 (GRCm39) V38E probably benign Het
Atp4a T C 7: 30,416,155 (GRCm39) S417P possibly damaging Het
AY358078 A G 14: 52,063,716 (GRCm39) N454S probably damaging Het
Cables2 A G 2: 179,903,450 (GRCm39) Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Camsap3 G A 8: 3,637,960 (GRCm39) probably null Het
Ccdc178 A T 18: 22,150,518 (GRCm39) V705E probably benign Het
Ccdc47 T C 11: 106,091,799 (GRCm39) Q472R possibly damaging Het
Ccdc62 A G 5: 124,089,283 (GRCm39) D307G probably damaging Het
Cdcp3 A G 7: 130,879,344 (GRCm39) T1788A unknown Het
Cdh23 A G 10: 60,366,775 (GRCm39) I235T probably benign Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cfap65 T C 1: 74,960,742 (GRCm39) N743D probably benign Het
Cimap1b T A 15: 89,262,610 (GRCm39) T116S probably benign Het
Clec16a A G 16: 10,398,827 (GRCm39) N329S probably null Het
Col25a1 A G 3: 130,340,006 (GRCm39) probably null Het
Daam1 T G 12: 72,035,713 (GRCm39) D969E probably benign Het
Dntt A C 19: 41,047,004 (GRCm39) probably null Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dst T A 1: 34,229,810 (GRCm39) Y2468N probably benign Het
Exosc9 A G 3: 36,615,297 (GRCm39) T262A possibly damaging Het
Exph5 G A 9: 53,288,309 (GRCm39) A1797T probably damaging Het
Fbp2 A T 13: 62,985,061 (GRCm39) Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fus T A 7: 127,581,123 (GRCm39) probably null Het
Galnt9 T A 5: 110,762,054 (GRCm39) N397K probably damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gga1 A G 15: 78,775,651 (GRCm39) T369A probably benign Het
Gp1ba T C 11: 70,531,119 (GRCm39) I295T unknown Het
Hk2 T C 6: 82,705,873 (GRCm39) E810G probably benign Het
Igsf10 A G 3: 59,233,189 (GRCm39) V1848A probably damaging Het
Insrr G A 3: 87,721,623 (GRCm39) probably null Het
Ip6k3 T A 17: 27,367,504 (GRCm39) M231L probably benign Het
Itgb8 T C 12: 119,155,939 (GRCm39) N171S probably benign Het
Ldlrad3 T C 2: 101,897,184 (GRCm39) probably null Het
Ltbp1 T A 17: 75,634,223 (GRCm39) C886* probably null Het
Mettl13 T C 1: 162,366,547 (GRCm39) D444G probably benign Het
Mns1 A G 9: 72,356,025 (GRCm39) Y224C probably damaging Het
Mri1 C T 8: 84,983,525 (GRCm39) R122Q probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo5c A C 9: 75,196,423 (GRCm39) K1290Q probably benign Het
Nlrp12 T G 7: 3,281,755 (GRCm39) Q842H possibly damaging Het
Oga G A 19: 45,755,895 (GRCm39) Q583* probably null Het
Or14c44 T C 7: 86,061,957 (GRCm39) L129P possibly damaging Het
Or14j8 T A 17: 38,263,413 (GRCm39) R167S probably benign Het
Or2t1 A T 14: 14,328,401 (GRCm38) T97S possibly damaging Het
Or5d39 T C 2: 87,979,620 (GRCm39) T248A possibly damaging Het
Otoa A G 7: 120,729,288 (GRCm39) T554A probably benign Het
Per1 A G 11: 68,994,008 (GRCm39) D438G probably damaging Het
Phactr3 G A 2: 177,975,854 (GRCm39) R533H probably damaging Het
Phykpl T C 11: 51,490,370 (GRCm39) F417S probably damaging Het
Pole A T 5: 110,482,330 (GRCm39) T2057S probably benign Het
Polq A G 16: 36,881,288 (GRCm39) T1151A probably benign Het
Polr1g T C 7: 19,093,073 (GRCm39) T36A probably benign Het
Rbm26 A T 14: 105,389,976 (GRCm39) V216E possibly damaging Het
Ryk T C 9: 102,775,737 (GRCm39) I449T probably damaging Het
Sap25 A G 5: 137,640,935 (GRCm39) T225A probably benign Het
Sart3 A G 5: 113,882,728 (GRCm39) M864T probably benign Het
Sec31b T C 19: 44,517,161 (GRCm39) S280G probably benign Het
Sema4d A T 13: 51,877,598 (GRCm39) I78N probably damaging Het
Sgip1 G C 4: 102,778,661 (GRCm39) R419S unknown Het
Slc13a3 T C 2: 165,272,210 (GRCm39) I278V probably benign Het
Slc2a5 A G 4: 150,224,439 (GRCm39) D312G probably benign Het
Slc39a2 A T 14: 52,131,660 (GRCm39) Q77L possibly damaging Het
Srbd1 A T 17: 86,443,782 (GRCm39) V148E probably benign Het
Syngr2 A G 11: 117,703,322 (GRCm39) E46G probably damaging Het
Taok1 A G 11: 77,470,643 (GRCm39) V54A possibly damaging Het
Tas2r106 T A 6: 131,655,185 (GRCm39) H222L probably damaging Het
Tmem151b G T 17: 45,856,195 (GRCm39) P415Q probably benign Het
Tmf1 T C 6: 97,145,061 (GRCm39) D659G possibly damaging Het
Tnn G T 1: 159,973,592 (GRCm39) D258E probably damaging Het
Traj33 A G 14: 54,422,862 (GRCm39) I16V unknown Het
Ttll13 G T 7: 79,906,772 (GRCm39) C480F probably damaging Het
Ttn T C 2: 76,714,415 (GRCm39) N8137S unknown Het
Vmn1r85 T C 7: 12,819,073 (GRCm39) N24D probably damaging Het
Wdr81 T C 11: 75,335,525 (GRCm39) Q649R probably null Het
Zan T C 5: 137,382,092 (GRCm39) T5152A unknown Het
Zc3h6 A G 2: 128,835,110 (GRCm39) D82G possibly damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGTGCTCCCTTGTTCAG -3'
(R):5'- TGAGTAGAGCCCATGTGAACTTAC -3'

Sequencing Primer
(F):5'- CAGGTGGTATTTGATCCTCTGCC -3'
(R):5'- GAGCCCATGTGAACTTACTCATATTC -3'
Posted On 2019-09-13