Incidental Mutation 'R7340:Mns1'
ID569779
Institutional Source Beutler Lab
Gene Symbol Mns1
Ensembl Gene ENSMUSG00000032221
Gene Namemeiosis-specific nuclear structural protein 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location72438011-72462025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72448743 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 224 (Y224C)
Ref Sequence ENSEMBL: ENSMUSP00000034746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034746] [ENSMUST00000183809] [ENSMUST00000184312] [ENSMUST00000184604]
Predicted Effect probably damaging
Transcript: ENSMUST00000034746
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034746
Gene: ENSMUSG00000032221
AA Change: Y224C

DomainStartEndE-ValueType
Pfam:TPH 117 462 3.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183809
SMART Domains Protein: ENSMUSP00000139105
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:Trichoplein 116 219 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184312
SMART Domains Protein: ENSMUSP00000138844
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184604
SMART Domains Protein: ENSMUSP00000139232
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:Trichoplein 116 158 8e-12 PFAM
Pfam:Trichoplein 150 206 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, male infertility, sperm flagellum abnormalities, immotile sperm, randomized left-right patterning, hydroencephaly, and motile cilia abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Daam1 T G 12: 71,988,939 D969E probably benign Het
Dntt A C 19: 41,058,565 probably null Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Olfr761 T A 17: 37,952,522 R167S probably benign Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Phykpl T C 11: 51,599,543 F417S probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sec31b T C 19: 44,528,722 S280G probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Slc39a2 A T 14: 51,894,203 Q77L possibly damaging Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Mns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Mns1 APN 9 72456913 unclassified probably benign
R0390:Mns1 UTSW 9 72452804 missense probably damaging 1.00
R0512:Mns1 UTSW 9 72449471 missense possibly damaging 0.87
R1803:Mns1 UTSW 9 72452734 missense probably damaging 1.00
R1988:Mns1 UTSW 9 72448759 unclassified probably null
R3821:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R3822:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R4640:Mns1 UTSW 9 72439282 missense probably benign 0.36
R6051:Mns1 UTSW 9 72449453 missense probably damaging 1.00
R6696:Mns1 UTSW 9 72452762 missense probably damaging 1.00
R6835:Mns1 UTSW 9 72452744 missense probably damaging 1.00
R7257:Mns1 UTSW 9 72452815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACGATAGGCTGCTGAAG -3'
(R):5'- CTCTGTACTTAAGCCGTGTGCC -3'

Sequencing Primer
(F):5'- CTGCTGAAGGAAGAGAGCGC -3'
(R):5'- ACGTGCTCTGACATATGAGATG -3'
Posted On2019-09-13