Incidental Mutation 'R7340:Phykpl'
ID569785
Institutional Source Beutler Lab
Gene Symbol Phykpl
Ensembl Gene ENSMUSG00000020359
Gene Name5-phosphohydroxy-L-lysine phospholyase
SynonymsAgxt2l2, 2900006B13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51584757-51604489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51599543 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 417 (F417S)
Ref Sequence ENSEMBL: ENSMUSP00000020625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020625] [ENSMUST00000074669] [ENSMUST00000101249] [ENSMUST00000101250] [ENSMUST00000109103] [ENSMUST00000167797]
Predicted Effect probably damaging
Transcript: ENSMUST00000020625
AA Change: F417S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020625
Gene: ENSMUSG00000020359
AA Change: F417S

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 27 433 2.1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074669
SMART Domains Protein: ENSMUSP00000074238
Gene: ENSMUSG00000020358

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101249
SMART Domains Protein: ENSMUSP00000098807
Gene: ENSMUSG00000020358

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101250
SMART Domains Protein: ENSMUSP00000098808
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 212 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109103
SMART Domains Protein: ENSMUSP00000104731
Gene: ENSMUSG00000020358

DomainStartEndE-ValueType
Pfam:CBFNT 1 75 5.7e-23 PFAM
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 313 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167797
AA Change: F417S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132190
Gene: ENSMUSG00000020359
AA Change: F417S

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 373 1.5e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: This gene overlaps in a tail-to-tail orientation the gene encoding heterogeneous nuclear ribonucleoprotein A/B. The terminal exon of this gene is interspersed with exons of heterogeneous nuclear ribonucleoprotein A/B. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Daam1 T G 12: 71,988,939 D969E probably benign Het
Dntt A C 19: 41,058,565 probably null Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mns1 A G 9: 72,448,743 Y224C probably damaging Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Olfr761 T A 17: 37,952,522 R167S probably benign Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sec31b T C 19: 44,528,722 S280G probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Slc39a2 A T 14: 51,894,203 Q77L possibly damaging Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Phykpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Phykpl APN 11 51599456 splice site probably benign
IGL01809:Phykpl APN 11 51599524 missense probably benign 0.09
IGL02636:Phykpl APN 11 51598713 missense probably damaging 1.00
IGL02668:Phykpl APN 11 51593687 critical splice donor site probably null
R0114:Phykpl UTSW 11 51586653 missense probably benign 0.00
R0308:Phykpl UTSW 11 51593596 splice site probably benign
R0332:Phykpl UTSW 11 51586675 missense probably benign 0.30
R0831:Phykpl UTSW 11 51585539 nonsense probably null
R3434:Phykpl UTSW 11 51598655 missense probably benign
R4272:Phykpl UTSW 11 51585528 missense probably damaging 1.00
R4539:Phykpl UTSW 11 51594088 missense probably damaging 1.00
R4618:Phykpl UTSW 11 51592229 missense probably damaging 1.00
R4633:Phykpl UTSW 11 51593608 missense probably damaging 1.00
R4816:Phykpl UTSW 11 51592953 missense probably benign
R4823:Phykpl UTSW 11 51586593 missense probably damaging 0.99
R5415:Phykpl UTSW 11 51585515 missense probably benign 0.00
R5920:Phykpl UTSW 11 51602795 missense probably benign
R6370:Phykpl UTSW 11 51586716 missense probably damaging 1.00
R6611:Phykpl UTSW 11 51598354 missense probably damaging 1.00
R6617:Phykpl UTSW 11 51593954 missense probably damaging 1.00
R7319:Phykpl UTSW 11 51598703 missense probably benign 0.20
R7499:Phykpl UTSW 11 51591458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCTTGGGTGAGGACAAG -3'
(R):5'- TGCCCATGTTTAGTCAGTGC -3'

Sequencing Primer
(F):5'- ACCTTGGGTGAGGACAAGTTAATTG -3'
(R):5'- GTTGCTACTGGTTACAAAGGCCATC -3'
Posted On2019-09-13