Incidental Mutation 'R7340:Daam1'
ID569792
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 71988939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 969 (D969E)
Ref Sequence ENSEMBL: ENSMUSP00000082406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably benign
Transcript: ENSMUST00000085299
AA Change: D969E

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: D969E

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000221317
AA Change: D960E

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000223272
AA Change: D969E

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Dntt A C 19: 41,058,565 probably null Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mns1 A G 9: 72,448,743 Y224C probably damaging Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Olfr761 T A 17: 37,952,522 R167S probably benign Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Phykpl T C 11: 51,599,543 F417S probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sec31b T C 19: 44,528,722 S280G probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Slc39a2 A T 14: 51,894,203 Q77L possibly damaging Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCTGGCTAAGAACCCTC -3'
(R):5'- GAGTATCTGTCGTCATGTGGCAC -3'

Sequencing Primer
(F):5'- GCTAAGAACCCTCCGTTGTATTTGAG -3'
(R):5'- GGGAAAGGCCAACCCACTG -3'
Posted On2019-09-13