Incidental Mutation 'R7340:Slc39a2'
ID569799
Institutional Source Beutler Lab
Gene Symbol Slc39a2
Ensembl Gene ENSMUSG00000072572
Gene Namesolute carrier family 39 (zinc transporter), member 2
Synonymszip2, F730005G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51892889-51896745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51894203 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 77 (Q77L)
Ref Sequence ENSEMBL: ENSMUSP00000038707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047726] [ENSMUST00000047899] [ENSMUST00000164252] [ENSMUST00000164902] [ENSMUST00000165100] [ENSMUST00000165568] [ENSMUST00000168217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047726
AA Change: Q77L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038707
Gene: ENSMUSG00000072572
AA Change: Q77L

DomainStartEndE-ValueType
Pfam:Zip 5 306 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047899
SMART Domains Protein: ENSMUSP00000047720
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 442 8e-65 PFAM
Pfam:Methyltransf_11 191 293 5.9e-7 PFAM
low complexity region 446 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164252
SMART Domains Protein: ENSMUSP00000130038
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164902
SMART Domains Protein: ENSMUSP00000130200
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 467 1.7e-61 PFAM
Pfam:Methyltransf_11 191 294 3.6e-6 PFAM
low complexity region 471 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165100
SMART Domains Protein: ENSMUSP00000132354
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165568
SMART Domains Protein: ENSMUSP00000129973
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
Pfam:Rsm22 100 269 1.5e-37 PFAM
Pfam:Methyltransf_11 138 240 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168217
SMART Domains Protein: ENSMUSP00000130565
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIP family of metal ion transporters. The encoded protein functions as a zinc transporter. Mutations in this gene may be associated with susceptibility to carotid artery disease. Multiple transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele are overtly normal when fed a zinc-replete diet but show increased sensitivity to the effects of maternal dietary zinc deficiency during pregnancy. Resulting embryos are often growth retarded with craniofacial and limb defects, and show altered iron and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Daam1 T G 12: 71,988,939 D969E probably benign Het
Dntt A C 19: 41,058,565 probably null Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mns1 A G 9: 72,448,743 Y224C probably damaging Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Olfr761 T A 17: 37,952,522 R167S probably benign Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Phykpl T C 11: 51,599,543 F417S probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sec31b T C 19: 44,528,722 S280G probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Slc39a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Slc39a2 APN 14 51895136 nonsense probably null
IGL02421:Slc39a2 APN 14 51893872 missense probably benign 0.00
IGL02546:Slc39a2 APN 14 51895163 missense probably benign 0.16
IGL02823:Slc39a2 APN 14 51895412 missense probably damaging 1.00
R1126:Slc39a2 UTSW 14 51894145 missense probably damaging 1.00
R4923:Slc39a2 UTSW 14 51895254 missense probably damaging 1.00
R5106:Slc39a2 UTSW 14 51895531 makesense probably null
R6158:Slc39a2 UTSW 14 51894224 unclassified probably null
R7094:Slc39a2 UTSW 14 51893689 unclassified probably benign
R7324:Slc39a2 UTSW 14 51894193 missense possibly damaging 0.74
R7578:Slc39a2 UTSW 14 51895416 missense probably damaging 1.00
R7599:Slc39a2 UTSW 14 51895031 missense probably benign 0.10
Z1177:Slc39a2 UTSW 14 51893895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACAGATGTTGAGTGCCATC -3'
(R):5'- CTGCCCTTTCAGCCAACAAG -3'

Sequencing Primer
(F):5'- TGAGTGCCATCTGTTGCTC -3'
(R):5'- GCCAACAAGCTTTCCTCAGATG -3'
Posted On2019-09-13