Incidental Mutation 'R7340:Olfr761'
ID569807
Institutional Source Beutler Lab
Gene Symbol Olfr761
Ensembl Gene ENSMUSG00000109376
Gene Nameolfactory receptor 761
SynonymsMOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37952051-37953079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37952522 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 167 (R167S)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
Predicted Effect probably benign
Transcript: ENSMUST00000049620
AA Change: R167S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: R167S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172723
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Daam1 T G 12: 71,988,939 D969E probably benign Het
Dntt A C 19: 41,058,565 probably null Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mns1 A G 9: 72,448,743 Y224C probably damaging Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Phykpl T C 11: 51,599,543 F417S probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sec31b T C 19: 44,528,722 S280G probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Slc39a2 A T 14: 51,894,203 Q77L possibly damaging Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Olfr761
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Olfr761 APN 17 37952851 missense probably damaging 1.00
IGL02104:Olfr761 APN 17 37952291 missense probably damaging 1.00
IGL02431:Olfr761 APN 17 37952522 missense probably benign 0.06
IGL02649:Olfr761 APN 17 37952973 missense probably damaging 1.00
IGL03109:Olfr761 APN 17 37952487 missense probably damaging 1.00
IGL03261:Olfr761 APN 17 37952806 missense possibly damaging 0.76
R0898:Olfr761 UTSW 17 37952236 missense probably benign 0.17
R1373:Olfr761 UTSW 17 37952360 missense probably damaging 1.00
R1527:Olfr761 UTSW 17 37952829 missense possibly damaging 0.88
R1664:Olfr761 UTSW 17 37952893 missense probably benign 0.44
R1835:Olfr761 UTSW 17 37952385 missense possibly damaging 0.79
R4124:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4125:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4128:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4534:Olfr761 UTSW 17 37952722 missense probably benign
R4557:Olfr761 UTSW 17 37952251 missense probably benign 0.10
R4790:Olfr761 UTSW 17 37952742 missense probably damaging 0.99
R4856:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4886:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4955:Olfr761 UTSW 17 37952898 missense probably damaging 1.00
R5162:Olfr761 UTSW 17 37952364 missense probably benign 0.00
R6016:Olfr761 UTSW 17 37952076 missense probably benign 0.13
R6282:Olfr761 UTSW 17 37952424 missense possibly damaging 0.80
R7018:Olfr761 UTSW 17 37952502 missense probably damaging 1.00
R7199:Olfr761 UTSW 17 37952157 missense probably damaging 1.00
R7360:Olfr761 UTSW 17 37953009 missense probably damaging 1.00
R7464:Olfr761 UTSW 17 37952280 missense probably damaging 1.00
X0064:Olfr761 UTSW 17 37952814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAAGACCTTAGATCTGCCTTC -3'
(R):5'- CATCTTTTGCCTGGGGAGAG -3'

Sequencing Primer
(F):5'- TCCTGAGAACTGTAGAGAATATCTGG -3'
(R):5'- AGAGCTGGGCACTCTCACAG -3'
Posted On2019-09-13