Incidental Mutation 'R7340:Dntt'
ID569813
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
SynonymsTdt
MMRRC Submission
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 41058565 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000087176] [ENSMUST00000112200]
PDB Structure Crystal Structure of the Catalytic Core of Murine Terminal Deoxynucleotidyl Transferase [X-RAY DIFFRACTION]
Binary Complex of Murine Terminal Deoxynucleotidyl Transferase with a Primer Single Stranded DNA [X-RAY DIFFRACTION]
Crystal Structure of Murine Terminal Deoxynucleotidyl Transferase complexed with ddATP [X-RAY DIFFRACTION]
Ternary complex of mouse TdT with ssDNA and incoming nucleotide [X-RAY DIFFRACTION]
Binary complex of mouse TdT with ssDNA and Zn++ [X-RAY DIFFRACTION]
Binary complex of mouse TdT with ssDNA and Mn++ [X-RAY DIFFRACTION]
Binary complex of mouse TdT with ssDNA in absence of divalent transition metal ion [X-RAY DIFFRACTION]
Ternary complex of mouse TdT with ssDNA and AMPcPP [X-RAY DIFFRACTION]
Ternary complex of mouse TdT with ssDNA and AMPcPP [X-RAY DIFFRACTION]
Binary complex of mouse TdT with AMPcPP [X-RAY DIFFRACTION]
>> 10 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000051806
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087176
SMART Domains Protein: ENSMUSP00000084422
Gene: ENSMUSG00000050121

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112200
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Daam1 T G 12: 71,988,939 D969E probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mns1 A G 9: 72,448,743 Y224C probably damaging Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Olfr761 T A 17: 37,952,522 R167S probably benign Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Phykpl T C 11: 51,599,543 F417S probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sec31b T C 19: 44,528,722 S280G probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Slc39a2 A T 14: 51,894,203 Q77L possibly damaging Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
R8145:Dntt UTSW 19 41055785 missense probably damaging 1.00
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTGAGAAACCCTGTCTC -3'
(R):5'- GTGAGCCCTTAATTTCAACCAAC -3'

Sequencing Primer
(F):5'- AAGTGAGGAGGGGGAAATGTTAG -3'
(R):5'- TAGCCAGCCAGTCAGCCAG -3'
Posted On2019-09-13