Incidental Mutation 'R7340:Sec31b'
ID569814
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7340 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44528722 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 280 (S280G)
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably benign
Transcript: ENSMUST00000063632
AA Change: S437G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: S437G

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111985
AA Change: S280G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: S280G

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,277,615 T1788A unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam30 A T 3: 98,162,321 N490I probably benign Het
Ankrd55 A T 13: 112,355,963 I223F probably damaging Het
Ano8 T A 8: 71,483,011 E321V probably damaging Het
Apc2 A G 10: 80,313,482 K1457E probably benign Het
Asb15 T A 6: 24,558,514 V38E probably benign Het
Atp4a T C 7: 30,716,730 S417P possibly damaging Het
AY358078 A G 14: 51,826,259 N454S probably damaging Het
Cables2 A G 2: 180,261,657 Y245H Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Ccdc178 A T 18: 22,017,461 V705E probably benign Het
Ccdc47 T C 11: 106,200,973 Q472R possibly damaging Het
Ccdc62 A G 5: 123,951,220 D307G probably damaging Het
Cd3eap T C 7: 19,359,148 T36A probably benign Het
Cdh23 A G 10: 60,530,996 I235T probably benign Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap65 T C 1: 74,921,583 N743D probably benign Het
Clec16a A G 16: 10,580,963 N329S probably null Het
Col25a1 A G 3: 130,546,357 probably null Het
Daam1 T G 12: 71,988,939 D969E probably benign Het
Dntt A C 19: 41,058,565 probably null Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dst T A 1: 34,190,729 Y2468N probably benign Het
Exosc9 A G 3: 36,561,148 T262A possibly damaging Het
Exph5 G A 9: 53,377,009 A1797T probably damaging Het
Fbp2 A T 13: 62,837,247 Y287N probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fus T A 7: 127,981,951 probably null Het
Galnt9 T A 5: 110,614,188 N397K probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gga1 A G 15: 78,891,451 T369A probably benign Het
Gp1ba T C 11: 70,640,293 I295T unknown Het
Hk2 T C 6: 82,728,892 E810G probably benign Het
Igsf10 A G 3: 59,325,768 V1848A probably damaging Het
Insrr G A 3: 87,814,316 probably null Het
Ip6k3 T A 17: 27,148,530 M231L probably benign Het
Itgb8 T C 12: 119,192,204 N171S probably benign Het
Ldlrad3 T C 2: 102,066,839 probably null Het
Ltbp1 T A 17: 75,327,228 C886* probably null Het
Mettl13 T C 1: 162,538,978 D444G probably benign Het
Mgea5 G A 19: 45,767,456 Q583* probably null Het
Mns1 A G 9: 72,448,743 Y224C probably damaging Het
Mri1 C T 8: 84,256,896 R122Q probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo5c A C 9: 75,289,141 K1290Q probably benign Het
Nlrp12 T G 7: 3,233,125 Q842H possibly damaging Het
Odf3b T A 15: 89,378,407 T116S probably benign Het
Olfr1167 T C 2: 88,149,276 T248A possibly damaging Het
Olfr301 T C 7: 86,412,749 L129P possibly damaging Het
Olfr31 A T 14: 14,328,401 T97S possibly damaging Het
Olfr761 T A 17: 37,952,522 R167S probably benign Het
Otoa A G 7: 121,130,065 T554A probably benign Het
Per1 A G 11: 69,103,182 D438G probably damaging Het
Phactr3 G A 2: 178,334,061 R533H probably damaging Het
Phykpl T C 11: 51,599,543 F417S probably damaging Het
Pole A T 5: 110,334,464 T2057S probably benign Het
Polq A G 16: 37,060,926 T1151A probably benign Het
Rbm26 A T 14: 105,152,540 V216E possibly damaging Het
Ryk T C 9: 102,898,538 I449T probably damaging Het
Sap25 A G 5: 137,642,673 T225A probably benign Het
Sart3 A G 5: 113,744,667 M864T probably benign Het
Sema4d A T 13: 51,723,562 I78N probably damaging Het
Sgip1 G C 4: 102,921,464 R419S unknown Het
Slc13a3 T C 2: 165,430,290 I278V probably benign Het
Slc2a5 A G 4: 150,139,982 D312G probably benign Het
Slc39a2 A T 14: 51,894,203 Q77L possibly damaging Het
Srbd1 A T 17: 86,136,354 V148E probably benign Het
Syngr2 A G 11: 117,812,496 E46G probably damaging Het
Taok1 A G 11: 77,579,817 V54A possibly damaging Het
Tas2r106 T A 6: 131,678,222 H222L probably damaging Het
Tcaf3 A G 6: 42,589,914 I747T probably benign Het
Tmem151b G T 17: 45,545,269 P415Q probably benign Het
Tmf1 T C 6: 97,168,100 D659G possibly damaging Het
Tnn G T 1: 160,146,022 D258E probably damaging Het
Traj33 A G 14: 54,185,405 I16V unknown Het
Ttll13 G T 7: 80,257,024 C480F probably damaging Het
Ttn T C 2: 76,884,071 N8137S unknown Het
Vmn1r85 T C 7: 13,085,146 N24D probably damaging Het
Wdr81 T C 11: 75,444,699 Q649R probably null Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zc3h6 A G 2: 128,993,190 D82G possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 intron probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7983:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCATCTGCCTTGGCTGG -3'
(R):5'- GGAAAGCTGGTTACTTTTGGCC -3'

Sequencing Primer
(F):5'- CTTGGCTGGCAAAGTATCCAG -3'
(R):5'- GGTTACTTTTGGCCTTCCCAG -3'
Posted On2019-09-13