Mutagenetix > Incidental Mutation

Incidental Mutation 'R7341:Dsel'

569817

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

045431-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R7341 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 111861573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 411 (G411S)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

AlphaFold

Q0VBN2

Predicted Effect

probably damaging
Transcript: ENSMUST00000035462
AA Change: G411S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: G411S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Meta Mutation Damage Score

0.5608

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (92/92)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Adam3	T	A	8: 24,687,980	N639I	possibly damaging	Het
Adamtsl3	T	A	7: 82,556,874	C756S	probably damaging	Het
AI314180	A	T	4: 58,809,415	V1653D	possibly damaging	Het
Arhgap31	C	T	16: 38,712,514		probably null	Het
Ascl4	G	A	10: 85,928,665	A59T	possibly damaging	Het
Ash1l	T	A	3: 88,981,759	I315N	possibly damaging	Het
Atp6v0d2	T	C	4: 19,887,330	D206G	possibly damaging	Het
Baz1b	T	A	5: 135,223,116	L923I	probably damaging	Het
BC067074	G	T	13: 113,318,172	G251C		Het
Birc6	T	A	17: 74,612,074	N1966K	probably damaging	Het
Bod1l	T	C	5: 41,788,857	N3025S	probably benign	Het
Bub1b	C	A	2: 118,636,786	H863Q	possibly damaging	Het
C1rb	T	A	6: 124,577,452	Y397*	probably null	Het
Ccdc180	A	G	4: 45,898,644	E164G	possibly damaging	Het
Ccdc9	C	T	7: 16,280,627	V230M	probably damaging	Het
Cchcr1	C	A	17: 35,526,713	N437K	probably benign	Het
Cdhr2	T	A	13: 54,719,492	L408Q	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Chd1	T	C	17: 15,770,237	S1684P	probably damaging	Het
CN725425	A	G	15: 91,242,670	Y221C	possibly damaging	Het
Col4a2	T	C	8: 11,398,678	V66A	probably damaging	Het
Cpd	C	A	11: 76,846,953	R5L	unknown	Het
Cpeb4	C	T	11: 31,918,807	T422I	possibly damaging	Het
Cyp1a1	G	T	9: 57,700,824	R245L	probably damaging	Het
Cyp4f39	A	G	17: 32,486,954	T340A	probably damaging	Het
Cyp4v3	A	T	8: 45,321,750	F122L	probably benign	Het
Drc1	T	A	5: 30,364,468	L728Q	probably damaging	Het
Ermp1	T	A	19: 29,646,254	H112L	probably benign	Het
Exoc8	T	C	8: 124,896,581	D349G	probably damaging	Het
Fam151a	T	A	4: 106,735,510	M63K	probably benign	Het
Fmo9	C	A	1: 166,676,546	G149V	probably damaging	Het
Fndc8	A	G	11: 82,898,777	T254A	possibly damaging	Het
Foxi3	G	A	6: 70,960,878	V365I	probably benign	Het
Frem2	C	T	3: 53,654,495	G864S	probably damaging	Het
Fstl5	T	A	3: 76,482,397		probably null	Het
Garnl3	T	A	2: 33,034,129	E247V	probably damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gorasp1	T	A	9: 119,937,534		probably benign	Het
Hcar2	T	C	5: 123,864,478	N321D	possibly damaging	Het
Hoxb6	G	T	11: 96,299,569	M131I	probably damaging	Het
Kif13a	A	G	13: 46,826,745	V177A	probably damaging	Het
Limch1	C	T	5: 67,034,202	T794I	probably benign	Het
Lmbrd2	A	G	15: 9,165,819	Y260C	possibly damaging	Het
Lmo7	A	G	14: 101,885,512	N379S	probably benign	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Lrrc14	A	T	15: 76,714,511	E449V	probably damaging	Het
Lrrc8c	T	C	5: 105,607,267	Y303H	probably damaging	Het
Mecr	T	G	4: 131,843,675	V58G	probably null	Het
Med12l	T	A	3: 59,042,403	D193E	possibly damaging	Het
Moap1	T	C	12: 102,743,179	E37G	probably damaging	Het
Mrgprb2	T	A	7: 48,552,896	Y27F	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Ndufs5	A	T	4: 123,715,951	C43*	probably null	Het
Oaz2	A	T	9: 65,688,901	D83V		Het
Olfr204	T	A	16: 59,315,149	N86I	possibly damaging	Het
Olfr329-ps	A	T	11: 58,542,707	Y269*	probably null	Het
Palm	A	G	10: 79,816,863	T191A	probably damaging	Het
Pclo	C	A	5: 14,675,836	D1569E	unknown	Het
Ppid	T	A	3: 79,600,297	D264E	probably benign	Het
Ppp1r3a	A	G	6: 14,718,750	S722P	probably damaging	Het
Ranbp2	A	G	10: 58,485,797	S2639G	possibly damaging	Het
Rbak	T	C	5: 143,176,072	T68A	probably benign	Het
Rbm15b	C	T	9: 106,885,047	G641R	probably benign	Het
Rgsl1	A	G	1: 153,793,845	I265T	probably benign	Het
Rmdn1	T	A	4: 19,586,837	Y98*	probably null	Het
Sfxn3	T	G	19: 45,049,262	N52K	probably benign	Het
Slc17a3	G	T	13: 23,846,884	G182*	probably null	Het
Slc29a3	A	T	10: 60,750,658	Y10N	probably benign	Het
Slc43a1	T	C	2: 84,862,934	Y577H	probably damaging	Het
Smarcd3	T	A	5: 24,595,437	I210F	possibly damaging	Het
Snapc4	A	T	2: 26,369,261	S626T	probably benign	Het
Sp5	T	A	2: 70,476,697	L242*	probably null	Het
Spata25	C	G	2: 164,827,662	G143A	probably damaging	Het
Spata6	T	A	4: 111,768,738	Y101*	probably null	Het
Tdp2	T	G	13: 24,832,076	S89A	probably benign	Het
Tlr6	T	C	5: 64,953,629	E645G	probably benign	Het
Tmem209	T	C	6: 30,494,795	I355V	probably benign	Het
Trappc8	A	T	18: 20,852,647	Y646N	probably damaging	Het
Tspoap1	A	G	11: 87,766,379	N399S	probably damaging	Het
Ube4b	A	G	4: 149,343,001	Y897H	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp9y	A	T	Y: 1,315,759		probably null	Het
Vmn2r1	T	C	3: 64,105,456	*913Q	probably null	Het
Vmn2r12	T	A	5: 109,086,247	T700S	possibly damaging	Het
Vmn2r12	C	T	5: 109,091,945	A251T	possibly damaging	Het
Wdr70	A	C	15: 7,924,244	F389V	possibly damaging	Het
Wdr91	A	T	6: 34,891,460	M442K	possibly damaging	Het
Ydjc	T	C	16: 17,150,898	C234R	probably benign	Het
Zfp72	A	G	13: 74,372,348	Y204H	possibly damaging	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7974:Dsel	UTSW	1	111860499	missense	probably benign	0.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
R8688:Dsel	UTSW	1	111862738	nonsense	probably null
R8819:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8820:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8923:Dsel	UTSW	1	111860554	missense	possibly damaging	0.85
R9014:Dsel	UTSW	1	111860779	nonsense	probably null
R9196:Dsel	UTSW	1	111860133	missense	probably benign	0.01
R9384:Dsel	UTSW	1	111860133	nonsense	probably null
R9427:Dsel	UTSW	1	111859695	missense	probably damaging	0.99
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCTCAGAAACGAATACCTG -3'
(R):5'- GGAGCTGGAAATTGGTTAGCTC -3'

Sequencing Primer
(F):5'- GAATACCTGCCCATTAGGAGCG -3'
(R):5'- TGGTTAGCTCAGCAAATTAGAAAGC -3'

Posted On

2019-09-13