Incidental Mutation 'R7341:Bub1b'
ID 569825
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene Name BUB1B, mitotic checkpoint serine/threonine kinase
Synonyms BUBR1
MMRRC Submission 045431-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7341 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 118428692-118472072 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 118467267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 863 (H863Q)
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341]
AlphaFold Q9Z1S0
Predicted Effect possibly damaging
Transcript: ENSMUST00000038341
AA Change: H863Q

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084
AA Change: H863Q

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Meta Mutation Damage Score 0.6244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Adam3 T A 8: 25,177,996 (GRCm39) N639I possibly damaging Het
Adamtsl3 T A 7: 82,206,082 (GRCm39) C756S probably damaging Het
Arhgap31 C T 16: 38,532,876 (GRCm39) probably null Het
Ascl4 G A 10: 85,764,529 (GRCm39) A59T possibly damaging Het
Ash1l T A 3: 88,889,066 (GRCm39) I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 (GRCm39) D206G possibly damaging Het
Baz1b T A 5: 135,251,970 (GRCm39) L923I probably damaging Het
Birc6 T A 17: 74,919,069 (GRCm39) N1966K probably damaging Het
Bod1l T C 5: 41,946,200 (GRCm39) N3025S probably benign Het
C1rb T A 6: 124,554,411 (GRCm39) Y397* probably null Het
Ccdc180 A G 4: 45,898,644 (GRCm39) E164G possibly damaging Het
Ccdc9 C T 7: 16,014,552 (GRCm39) V230M probably damaging Het
Cchcr1 C A 17: 35,837,610 (GRCm39) N437K probably benign Het
Cdhr2 T A 13: 54,867,305 (GRCm39) L408Q probably damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Chd1 T C 17: 15,990,499 (GRCm39) S1684P probably damaging Het
CN725425 A G 15: 91,126,873 (GRCm39) Y221C possibly damaging Het
Col4a2 T C 8: 11,448,678 (GRCm39) V66A probably damaging Het
Cpd C A 11: 76,737,779 (GRCm39) R5L unknown Het
Cpeb4 C T 11: 31,868,807 (GRCm39) T422I possibly damaging Het
Cspg4b G T 13: 113,454,706 (GRCm39) G251C Het
Cyp1a1 G T 9: 57,608,107 (GRCm39) R245L probably damaging Het
Cyp4f39 A G 17: 32,705,928 (GRCm39) T340A probably damaging Het
Cyp4v3 A T 8: 45,774,787 (GRCm39) F122L probably benign Het
Drc1 T A 5: 30,521,812 (GRCm39) L728Q probably damaging Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Ecpas A T 4: 58,809,415 (GRCm39) V1653D possibly damaging Het
Ermp1 T A 19: 29,623,654 (GRCm39) H112L probably benign Het
Exoc8 T C 8: 125,623,320 (GRCm39) D349G probably damaging Het
Fam151a T A 4: 106,592,707 (GRCm39) M63K probably benign Het
Fmo9 C A 1: 166,504,115 (GRCm39) G149V probably damaging Het
Fndc8 A G 11: 82,789,603 (GRCm39) T254A possibly damaging Het
Foxi3 G A 6: 70,937,862 (GRCm39) V365I probably benign Het
Frem2 C T 3: 53,561,916 (GRCm39) G864S probably damaging Het
Fstl5 T A 3: 76,389,704 (GRCm39) probably null Het
Garnl3 T A 2: 32,924,141 (GRCm39) E247V probably damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gorasp1 T A 9: 119,766,600 (GRCm39) probably benign Het
Hcar2 T C 5: 124,002,541 (GRCm39) N321D possibly damaging Het
Hoxb6 G T 11: 96,190,395 (GRCm39) M131I probably damaging Het
Kif13a A G 13: 46,980,221 (GRCm39) V177A probably damaging Het
Limch1 C T 5: 67,191,545 (GRCm39) T794I probably benign Het
Lmbrd2 A G 15: 9,165,906 (GRCm39) Y260C possibly damaging Het
Lmo7 A G 14: 102,122,948 (GRCm39) N379S probably benign Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Lrrc14 A T 15: 76,598,711 (GRCm39) E449V probably damaging Het
Lrrc8c T C 5: 105,755,133 (GRCm39) Y303H probably damaging Het
Mecr T G 4: 131,570,986 (GRCm39) V58G probably null Het
Med12l T A 3: 58,949,824 (GRCm39) D193E possibly damaging Het
Moap1 T C 12: 102,709,438 (GRCm39) E37G probably damaging Het
Mrgprb2 T A 7: 48,202,644 (GRCm39) Y27F probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Ndufs5 A T 4: 123,609,744 (GRCm39) C43* probably null Het
Oaz2 A T 9: 65,596,183 (GRCm39) D83V Het
Or2t29 A T 11: 58,433,533 (GRCm39) Y269* probably null Het
Or5ac22 T A 16: 59,135,512 (GRCm39) N86I possibly damaging Het
Palm A G 10: 79,652,697 (GRCm39) T191A probably damaging Het
Pclo C A 5: 14,725,850 (GRCm39) D1569E unknown Het
Ppid T A 3: 79,507,604 (GRCm39) D264E probably benign Het
Ppp1r3a A G 6: 14,718,749 (GRCm39) S722P probably damaging Het
Ranbp2 A G 10: 58,321,619 (GRCm39) S2639G possibly damaging Het
Rbak T C 5: 143,161,827 (GRCm39) T68A probably benign Het
Rbm15b C T 9: 106,762,246 (GRCm39) G641R probably benign Het
Rgsl1 A G 1: 153,669,591 (GRCm39) I265T probably benign Het
Rmdn1 T A 4: 19,586,837 (GRCm39) Y98* probably null Het
Sfxn3 T G 19: 45,037,701 (GRCm39) N52K probably benign Het
Slc17a3 G T 13: 24,030,867 (GRCm39) G182* probably null Het
Slc29a3 A T 10: 60,586,437 (GRCm39) Y10N probably benign Het
Slc43a1 T C 2: 84,693,278 (GRCm39) Y577H probably damaging Het
Smarcd3 T A 5: 24,800,435 (GRCm39) I210F possibly damaging Het
Snapc4 A T 2: 26,259,273 (GRCm39) S626T probably benign Het
Sp5 T A 2: 70,307,041 (GRCm39) L242* probably null Het
Spata25 C G 2: 164,669,582 (GRCm39) G143A probably damaging Het
Spata6 T A 4: 111,625,935 (GRCm39) Y101* probably null Het
Tdp2 T G 13: 25,016,059 (GRCm39) S89A probably benign Het
Tlr6 T C 5: 65,110,972 (GRCm39) E645G probably benign Het
Tmem209 T C 6: 30,494,794 (GRCm39) I355V probably benign Het
Trappc8 A T 18: 20,985,704 (GRCm39) Y646N probably damaging Het
Tspoap1 A G 11: 87,657,205 (GRCm39) N399S probably damaging Het
Ube4b A G 4: 149,427,458 (GRCm39) Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Usp9y A T Y: 1,315,759 (GRCm39) probably null Het
Vmn2r1 T C 3: 64,012,877 (GRCm39) *913Q probably null Het
Vmn2r12 T A 5: 109,234,113 (GRCm39) T700S possibly damaging Het
Vmn2r12 C T 5: 109,239,811 (GRCm39) A251T possibly damaging Het
Wdr70 A C 15: 7,953,725 (GRCm39) F389V possibly damaging Het
Wdr91 A T 6: 34,868,395 (GRCm39) M442K possibly damaging Het
Ydjc T C 16: 16,968,762 (GRCm39) C234R probably benign Het
Zfp87 A G 13: 74,520,467 (GRCm39) Y204H possibly damaging Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118,460,619 (GRCm39) missense probably benign
IGL01319:Bub1b APN 2 118,445,475 (GRCm39) missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118,467,230 (GRCm39) missense probably damaging 0.99
IGL03184:Bub1b APN 2 118,440,258 (GRCm39) splice site probably benign
P0035:Bub1b UTSW 2 118,452,666 (GRCm39) missense probably damaging 1.00
R0315:Bub1b UTSW 2 118,457,457 (GRCm39) splice site probably benign
R0322:Bub1b UTSW 2 118,470,099 (GRCm39) splice site probably benign
R0378:Bub1b UTSW 2 118,471,604 (GRCm39) missense probably benign 0.01
R0457:Bub1b UTSW 2 118,440,340 (GRCm39) missense probably damaging 1.00
R0845:Bub1b UTSW 2 118,440,457 (GRCm39) missense probably damaging 1.00
R0960:Bub1b UTSW 2 118,437,161 (GRCm39) missense probably benign 0.03
R1071:Bub1b UTSW 2 118,462,928 (GRCm39) frame shift probably null
R1129:Bub1b UTSW 2 118,445,487 (GRCm39) missense probably damaging 1.00
R1138:Bub1b UTSW 2 118,453,570 (GRCm39) missense probably benign 0.01
R1171:Bub1b UTSW 2 118,437,167 (GRCm39) missense probably benign 0.31
R1613:Bub1b UTSW 2 118,470,222 (GRCm39) critical splice donor site probably null
R1667:Bub1b UTSW 2 118,471,670 (GRCm39) missense probably benign 0.00
R1812:Bub1b UTSW 2 118,462,902 (GRCm39) missense probably benign 0.00
R1828:Bub1b UTSW 2 118,468,920 (GRCm39) missense probably benign 0.00
R2085:Bub1b UTSW 2 118,452,676 (GRCm39) missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118,467,199 (GRCm39) nonsense probably null
R3749:Bub1b UTSW 2 118,445,936 (GRCm39) missense possibly damaging 0.63
R3750:Bub1b UTSW 2 118,445,936 (GRCm39) missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118,461,459 (GRCm39) missense possibly damaging 0.78
R4579:Bub1b UTSW 2 118,453,657 (GRCm39) nonsense probably null
R4993:Bub1b UTSW 2 118,467,251 (GRCm39) missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118,445,980 (GRCm39) missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118,460,470 (GRCm39) missense probably damaging 1.00
R5596:Bub1b UTSW 2 118,461,463 (GRCm39) missense probably damaging 1.00
R5656:Bub1b UTSW 2 118,435,912 (GRCm39) missense probably damaging 1.00
R5785:Bub1b UTSW 2 118,440,325 (GRCm39) missense probably damaging 0.98
R5883:Bub1b UTSW 2 118,440,363 (GRCm39) missense probably damaging 1.00
R6128:Bub1b UTSW 2 118,448,293 (GRCm39) missense probably benign
R6187:Bub1b UTSW 2 118,461,481 (GRCm39) missense probably damaging 1.00
R6333:Bub1b UTSW 2 118,428,944 (GRCm39) critical splice donor site probably null
R6985:Bub1b UTSW 2 118,437,095 (GRCm39) missense probably damaging 1.00
R6988:Bub1b UTSW 2 118,467,311 (GRCm39) missense probably damaging 0.96
R7161:Bub1b UTSW 2 118,456,534 (GRCm39) missense probably damaging 1.00
R7575:Bub1b UTSW 2 118,471,639 (GRCm39) missense possibly damaging 0.51
R7824:Bub1b UTSW 2 118,457,448 (GRCm39) splice site probably null
R8129:Bub1b UTSW 2 118,468,975 (GRCm39) missense probably benign 0.06
R8702:Bub1b UTSW 2 118,468,975 (GRCm39) missense probably benign 0.06
R8787:Bub1b UTSW 2 118,462,305 (GRCm39) missense probably damaging 1.00
R9569:Bub1b UTSW 2 118,468,884 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGAGACCTCGGTGTTC -3'
(R):5'- GCTTTACACATGCAAGGCAAG -3'

Sequencing Primer
(F):5'- AGACCTCGGTGTTCAGCTG -3'
(R):5'- ATTCCAGTTCCAGAGGTGC -3'
Posted On 2019-09-13