Incidental Mutation 'R7341:Frem2'
ID569827
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7341 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53654495 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 864 (G864S)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: G864S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: G864S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Bhlha9 G C 11: 76,672,579 G11R probably benign Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAACGTTCACTCTGAGAG -3'
(R):5'- TGGCTCAGTTCCAGTTCCAAG -3'

Sequencing Primer
(F):5'- ATCCCCGCTATTCCAGTA -3'
(R):5'- CTCAGTTCCAGTTCCAAGTAGAGG -3'
Posted On2019-09-13