Incidental Mutation 'R7341:Ppid'
ID569830
Institutional Source Beutler Lab
Gene Symbol Ppid
Ensembl Gene ENSMUSG00000027804
Gene Namepeptidylprolyl isomerase D (cyclophilin D)
Synonymscyclophilin 40, 4930564J03Rik, cytoplasmic cyclophilin D, Ppidl, CYP-40
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R7341 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location79591342-79603650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79600297 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 264 (D264E)
Ref Sequence ENSEMBL: ENSMUSP00000029382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029382] [ENSMUST00000029386] [ENSMUST00000120992]
Predicted Effect probably benign
Transcript: ENSMUST00000029382
AA Change: D264E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029382
Gene: ENSMUSG00000027804
AA Change: D264E

DomainStartEndE-ValueType
Pfam:Pro_isomerase 19 183 1.5e-49 PFAM
low complexity region 208 222 N/A INTRINSIC
TPR 223 256 1.78e-1 SMART
TPR 273 306 2.59e-3 SMART
TPR 307 340 2.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029386
SMART Domains Protein: ENSMUSP00000029386
Gene: ENSMUSG00000027809

DomainStartEndE-ValueType
Pfam:Thi4 57 123 5.3e-9 PFAM
Pfam:FAD_binding_2 69 120 1.7e-7 PFAM
Pfam:Lycopene_cycl 69 125 5.7e-8 PFAM
Pfam:NAD_binding_8 72 122 9.7e-8 PFAM
Pfam:ETF_QO 511 614 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120992
SMART Domains Protein: ENSMUSP00000113888
Gene: ENSMUSG00000027809

DomainStartEndE-ValueType
Pfam:Thi4 1 63 2e-8 PFAM
Pfam:FAD_binding_2 9 59 4.7e-8 PFAM
Pfam:Pyr_redox_2 9 209 1.7e-7 PFAM
Pfam:NAD_binding_9 11 56 2.1e-7 PFAM
Pfam:NAD_binding_8 12 61 2.8e-8 PFAM
Pfam:ETF_QO 402 511 3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159505
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein has been shown to possess PPIase activity and, similar to other family members, can bind to the immunosuppressant cyclosporin A. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Arhgap31 C T 16: 38,712,514 probably null Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Fstl5 T A 3: 76,482,397 probably null Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp9y A T Y: 1,315,759 probably null Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in Ppid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Ppid APN 3 79595277 missense probably damaging 1.00
IGL01718:Ppid APN 3 79593679 missense probably damaging 1.00
IGL02347:Ppid APN 3 79595219 missense probably benign 0.00
R1109:Ppid UTSW 3 79598861 missense probably benign 0.01
R1965:Ppid UTSW 3 79602299 nonsense probably null
R1966:Ppid UTSW 3 79602299 nonsense probably null
R1980:Ppid UTSW 3 79593618 missense probably damaging 0.96
R4706:Ppid UTSW 3 79599052 missense probably benign
R4820:Ppid UTSW 3 79595197 splice site probably null
R5969:Ppid UTSW 3 79597717 missense probably damaging 1.00
R6243:Ppid UTSW 3 79603066 missense probably benign 0.01
R7246:Ppid UTSW 3 79591433 unclassified probably benign
R7576:Ppid UTSW 3 79600391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAGAAACAGTGTGGAGTTAC -3'
(R):5'- AAGTCTCATTAGGTGCTAGGC -3'

Sequencing Primer
(F):5'- AGACAGGATTTCTCTGTGTAGCCC -3'
(R):5'- AGCAACTGTCAATTGCCC -3'
Posted On2019-09-13