Incidental Mutation 'R7341:Bod1l'
ID569844
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7341 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41788857 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3025 (N3025S)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably benign
Transcript: ENSMUST00000050556
AA Change: N3025S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: N3025S

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202908
AA Change: N2978S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: N2978S

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Arhgap31 C T 16: 38,712,514 probably null Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Fstl5 T A 3: 76,482,397 probably null Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp9y A T Y: 1,315,759 probably null Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
R7860:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R7943:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R8104:Bod1l UTSW 5 41833732 nonsense probably null
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGAAGTGAATGTACATAATACCGTCC -3'
(R):5'- TCTGGTATTAAAGACCGTGGGG -3'

Sequencing Primer
(F):5'- GTACATAATACCGTCCATGAACAATG -3'
(R):5'- ATTAAAGACCGTGGGGATTTCC -3'
Posted On2019-09-13