Incidental Mutation 'R7341:Vmn2r12'
ID 569849
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Name vomeronasal 2, receptor 12
Synonyms Gm6769
MMRRC Submission 045431-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7341 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109233715-109245730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109239811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 251 (A251T)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
AlphaFold L7N217
Predicted Effect possibly damaging
Transcript: ENSMUST00000095922
AA Change: A251T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: A251T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Adam3 T A 8: 25,177,996 (GRCm39) N639I possibly damaging Het
Adamtsl3 T A 7: 82,206,082 (GRCm39) C756S probably damaging Het
Arhgap31 C T 16: 38,532,876 (GRCm39) probably null Het
Ascl4 G A 10: 85,764,529 (GRCm39) A59T possibly damaging Het
Ash1l T A 3: 88,889,066 (GRCm39) I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 (GRCm39) D206G possibly damaging Het
Baz1b T A 5: 135,251,970 (GRCm39) L923I probably damaging Het
Birc6 T A 17: 74,919,069 (GRCm39) N1966K probably damaging Het
Bod1l T C 5: 41,946,200 (GRCm39) N3025S probably benign Het
Bub1b C A 2: 118,467,267 (GRCm39) H863Q possibly damaging Het
C1rb T A 6: 124,554,411 (GRCm39) Y397* probably null Het
Ccdc180 A G 4: 45,898,644 (GRCm39) E164G possibly damaging Het
Ccdc9 C T 7: 16,014,552 (GRCm39) V230M probably damaging Het
Cchcr1 C A 17: 35,837,610 (GRCm39) N437K probably benign Het
Cdhr2 T A 13: 54,867,305 (GRCm39) L408Q probably damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Chd1 T C 17: 15,990,499 (GRCm39) S1684P probably damaging Het
CN725425 A G 15: 91,126,873 (GRCm39) Y221C possibly damaging Het
Col4a2 T C 8: 11,448,678 (GRCm39) V66A probably damaging Het
Cpd C A 11: 76,737,779 (GRCm39) R5L unknown Het
Cpeb4 C T 11: 31,868,807 (GRCm39) T422I possibly damaging Het
Cspg4b G T 13: 113,454,706 (GRCm39) G251C Het
Cyp1a1 G T 9: 57,608,107 (GRCm39) R245L probably damaging Het
Cyp4f39 A G 17: 32,705,928 (GRCm39) T340A probably damaging Het
Cyp4v3 A T 8: 45,774,787 (GRCm39) F122L probably benign Het
Drc1 T A 5: 30,521,812 (GRCm39) L728Q probably damaging Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Ecpas A T 4: 58,809,415 (GRCm39) V1653D possibly damaging Het
Ermp1 T A 19: 29,623,654 (GRCm39) H112L probably benign Het
Exoc8 T C 8: 125,623,320 (GRCm39) D349G probably damaging Het
Fam151a T A 4: 106,592,707 (GRCm39) M63K probably benign Het
Fmo9 C A 1: 166,504,115 (GRCm39) G149V probably damaging Het
Fndc8 A G 11: 82,789,603 (GRCm39) T254A possibly damaging Het
Foxi3 G A 6: 70,937,862 (GRCm39) V365I probably benign Het
Frem2 C T 3: 53,561,916 (GRCm39) G864S probably damaging Het
Fstl5 T A 3: 76,389,704 (GRCm39) probably null Het
Garnl3 T A 2: 32,924,141 (GRCm39) E247V probably damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gorasp1 T A 9: 119,766,600 (GRCm39) probably benign Het
Hcar2 T C 5: 124,002,541 (GRCm39) N321D possibly damaging Het
Hoxb6 G T 11: 96,190,395 (GRCm39) M131I probably damaging Het
Kif13a A G 13: 46,980,221 (GRCm39) V177A probably damaging Het
Limch1 C T 5: 67,191,545 (GRCm39) T794I probably benign Het
Lmbrd2 A G 15: 9,165,906 (GRCm39) Y260C possibly damaging Het
Lmo7 A G 14: 102,122,948 (GRCm39) N379S probably benign Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Lrrc14 A T 15: 76,598,711 (GRCm39) E449V probably damaging Het
Lrrc8c T C 5: 105,755,133 (GRCm39) Y303H probably damaging Het
Mecr T G 4: 131,570,986 (GRCm39) V58G probably null Het
Med12l T A 3: 58,949,824 (GRCm39) D193E possibly damaging Het
Moap1 T C 12: 102,709,438 (GRCm39) E37G probably damaging Het
Mrgprb2 T A 7: 48,202,644 (GRCm39) Y27F probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Ndufs5 A T 4: 123,609,744 (GRCm39) C43* probably null Het
Oaz2 A T 9: 65,596,183 (GRCm39) D83V Het
Or2t29 A T 11: 58,433,533 (GRCm39) Y269* probably null Het
Or5ac22 T A 16: 59,135,512 (GRCm39) N86I possibly damaging Het
Palm A G 10: 79,652,697 (GRCm39) T191A probably damaging Het
Pclo C A 5: 14,725,850 (GRCm39) D1569E unknown Het
Ppid T A 3: 79,507,604 (GRCm39) D264E probably benign Het
Ppp1r3a A G 6: 14,718,749 (GRCm39) S722P probably damaging Het
Ranbp2 A G 10: 58,321,619 (GRCm39) S2639G possibly damaging Het
Rbak T C 5: 143,161,827 (GRCm39) T68A probably benign Het
Rbm15b C T 9: 106,762,246 (GRCm39) G641R probably benign Het
Rgsl1 A G 1: 153,669,591 (GRCm39) I265T probably benign Het
Rmdn1 T A 4: 19,586,837 (GRCm39) Y98* probably null Het
Sfxn3 T G 19: 45,037,701 (GRCm39) N52K probably benign Het
Slc17a3 G T 13: 24,030,867 (GRCm39) G182* probably null Het
Slc29a3 A T 10: 60,586,437 (GRCm39) Y10N probably benign Het
Slc43a1 T C 2: 84,693,278 (GRCm39) Y577H probably damaging Het
Smarcd3 T A 5: 24,800,435 (GRCm39) I210F possibly damaging Het
Snapc4 A T 2: 26,259,273 (GRCm39) S626T probably benign Het
Sp5 T A 2: 70,307,041 (GRCm39) L242* probably null Het
Spata25 C G 2: 164,669,582 (GRCm39) G143A probably damaging Het
Spata6 T A 4: 111,625,935 (GRCm39) Y101* probably null Het
Tdp2 T G 13: 25,016,059 (GRCm39) S89A probably benign Het
Tlr6 T C 5: 65,110,972 (GRCm39) E645G probably benign Het
Tmem209 T C 6: 30,494,794 (GRCm39) I355V probably benign Het
Trappc8 A T 18: 20,985,704 (GRCm39) Y646N probably damaging Het
Tspoap1 A G 11: 87,657,205 (GRCm39) N399S probably damaging Het
Ube4b A G 4: 149,427,458 (GRCm39) Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Usp9y A T Y: 1,315,759 (GRCm39) probably null Het
Vmn2r1 T C 3: 64,012,877 (GRCm39) *913Q probably null Het
Wdr70 A C 15: 7,953,725 (GRCm39) F389V possibly damaging Het
Wdr91 A T 6: 34,868,395 (GRCm39) M442K possibly damaging Het
Ydjc T C 16: 16,968,762 (GRCm39) C234R probably benign Het
Zfp87 A G 13: 74,520,467 (GRCm39) Y204H possibly damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109,245,541 (GRCm39) missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109,234,125 (GRCm39) missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109,239,716 (GRCm39) missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109,240,893 (GRCm39) nonsense probably null
IGL01762:Vmn2r12 APN 5 109,234,430 (GRCm39) missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109,240,025 (GRCm39) missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109,234,343 (GRCm39) missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109,233,858 (GRCm39) missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109,238,351 (GRCm39) missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109,239,936 (GRCm39) missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109,240,765 (GRCm39) missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109,239,755 (GRCm39) nonsense probably null
R0529:Vmn2r12 UTSW 5 109,240,714 (GRCm39) missense probably benign
R0715:Vmn2r12 UTSW 5 109,238,373 (GRCm39) missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109,234,281 (GRCm39) missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109,235,716 (GRCm39) critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109,239,763 (GRCm39) missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109,240,840 (GRCm39) missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109,240,696 (GRCm39) missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109,239,910 (GRCm39) missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109,239,594 (GRCm39) missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109,239,942 (GRCm39) missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109,239,340 (GRCm39) missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109,238,370 (GRCm39) missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109,239,412 (GRCm39) missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109,234,301 (GRCm39) missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109,234,379 (GRCm39) missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109,240,852 (GRCm39) missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109,239,544 (GRCm39) missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109,239,372 (GRCm39) missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109,238,261 (GRCm39) missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109,239,684 (GRCm39) missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109,234,483 (GRCm39) nonsense probably null
R5639:Vmn2r12 UTSW 5 109,240,666 (GRCm39) missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109,239,670 (GRCm39) missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109,233,736 (GRCm39) nonsense probably null
R6142:Vmn2r12 UTSW 5 109,240,763 (GRCm39) missense probably benign
R6162:Vmn2r12 UTSW 5 109,234,430 (GRCm39) missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109,233,866 (GRCm39) missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109,240,771 (GRCm39) missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109,245,655 (GRCm39) missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109,234,113 (GRCm39) missense possibly damaging 0.74
R7383:Vmn2r12 UTSW 5 109,240,684 (GRCm39) missense probably benign 0.19
R7740:Vmn2r12 UTSW 5 109,239,615 (GRCm39) missense probably damaging 1.00
R7749:Vmn2r12 UTSW 5 109,233,920 (GRCm39) missense probably damaging 0.99
R7861:Vmn2r12 UTSW 5 109,235,829 (GRCm39) missense probably benign 0.00
R7908:Vmn2r12 UTSW 5 109,234,307 (GRCm39) missense probably damaging 1.00
R8128:Vmn2r12 UTSW 5 109,239,747 (GRCm39) missense possibly damaging 0.81
R8175:Vmn2r12 UTSW 5 109,238,349 (GRCm39) missense probably damaging 0.97
R8234:Vmn2r12 UTSW 5 109,234,074 (GRCm39) missense probably benign 0.01
R8771:Vmn2r12 UTSW 5 109,239,952 (GRCm39) missense possibly damaging 0.95
R8947:Vmn2r12 UTSW 5 109,234,522 (GRCm39) missense possibly damaging 0.64
R8991:Vmn2r12 UTSW 5 109,234,033 (GRCm39) nonsense probably null
R9116:Vmn2r12 UTSW 5 109,233,885 (GRCm39) missense probably damaging 1.00
R9122:Vmn2r12 UTSW 5 109,240,910 (GRCm39) missense probably benign 0.00
R9153:Vmn2r12 UTSW 5 109,234,203 (GRCm39) missense probably damaging 1.00
R9371:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R9375:Vmn2r12 UTSW 5 109,233,986 (GRCm39) missense probably damaging 1.00
R9524:Vmn2r12 UTSW 5 109,239,823 (GRCm39) missense probably damaging 1.00
R9587:Vmn2r12 UTSW 5 109,239,322 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r12 UTSW 5 109,240,646 (GRCm39) missense probably benign
Z1176:Vmn2r12 UTSW 5 109,239,303 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGTGCAAAAGTGACAGTCCC -3'
(R):5'- CACACACTTGTCCCATGGTATGG -3'

Sequencing Primer
(F):5'- TGACAGTCCCTTGGAAGAAATC -3'
(R):5'- CCATGGTATGGTCTCCTTGATGC -3'
Posted On 2019-09-13