Incidental Mutation 'R7341:C1rb'
ID569857
Institutional Source Beutler Lab
Gene Symbol C1rb
Ensembl Gene ENSMUSG00000098470
Gene Namecomplement component 1, r subcomponent B
SynonymsGm8551, mC1rB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R7341 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124570294-124581171 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 124577452 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 397 (Y397*)
Ref Sequence ENSEMBL: ENSMUSP00000139376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184647]
Predicted Effect probably null
Transcript: ENSMUST00000184647
AA Change: Y397*
SMART Domains Protein: ENSMUSP00000139376
Gene: ENSMUSG00000098470
AA Change: Y397*

DomainStartEndE-ValueType
CUB 14 140 2.21e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 2.42e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 698 5.36e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Arhgap31 C T 16: 38,712,514 probably null Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Fstl5 T A 3: 76,482,397 probably null Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp9y A T Y: 1,315,759 probably null Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in C1rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3722:C1rb UTSW 6 124580661 missense probably damaging 1.00
R4806:C1rb UTSW 6 124574949 missense probably benign 0.18
R5095:C1rb UTSW 6 124580313 missense possibly damaging 0.91
R5572:C1rb UTSW 6 124580799 missense probably benign
R6223:C1rb UTSW 6 124574580 missense probably benign 0.06
R6769:C1rb UTSW 6 124577405 missense probably benign 0.00
R6771:C1rb UTSW 6 124577405 missense probably benign 0.00
R7204:C1rb UTSW 6 124577427 missense probably benign
R7335:C1rb UTSW 6 124575279 missense possibly damaging 0.87
R7554:C1rb UTSW 6 124580406 missense probably damaging 1.00
R7604:C1rb UTSW 6 124580484 missense not run
R7753:C1rb UTSW 6 124580431 missense probably benign 0.00
R7813:C1rb UTSW 6 124580529 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTCCAACCTGATGGGCTC -3'
(R):5'- GTTGGTACTCAGGACTCCAC -3'

Sequencing Primer
(F):5'- ACCCTATCTAGTGCAAGTGTG -3'
(R):5'- TTGGTACTCAGGACTCCACTGAAG -3'
Posted On2019-09-13