Mutagenetix > Incidental Mutation

Incidental Mutation 'R7341:Lrp6'

569858

Institutional Source

Beutler Lab

Gene Symbol

Lrp6

Ensembl Gene

ENSMUSG00000030201

Gene Name

low density lipoprotein receptor-related protein 6

Synonyms

skax26, Cd, ska26, ska

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R7341 (G1)

Quality Score

164.009

Status

Validated

Chromosome

Chromosomal Location

134446476-134566965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 134450818 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 1604 (P1604T)

Ref Sequence

ENSEMBL: ENSMUSP00000032322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032322]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032322
AA Change: P1604T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: P1604T

Domain	Start	End	E-Value	Type
LY	43	85	1.55e-2	SMART
LY	87	129	1.91e-11	SMART
LY	130	173	5.19e-13	SMART
LY	174	216	1.39e-13	SMART
LY	217	258	2.87e-6	SMART
EGF	285	324	2.16e-1	SMART
low complexity region	330	341	N/A	INTRINSIC
LY	352	394	1.29e-8	SMART
LY	395	437	5.73e-15	SMART
LY	438	481	1.07e-14	SMART
LY	482	524	3.07e-15	SMART
LY	525	565	4.66e-6	SMART
EGF	591	628	1.47e-3	SMART
LY	654	696	2.06e-7	SMART
LY	697	739	3.73e-14	SMART
LY	740	783	3.37e-12	SMART
LY	784	825	1.17e-6	SMART
LY	827	865	1.91e-2	SMART
EGF	892	930	7.35e-4	SMART
LY	957	999	1.41e-5	SMART
LY	1005	1048	5.32e-1	SMART
LY	1049	1093	5e-6	SMART
LY	1094	1136	4.25e-9	SMART
LY	1137	1177	1.91e-2	SMART
EGF	1206	1250	1.23e1	SMART
LDLa	1248	1287	2.42e-12	SMART
LDLa	1288	1324	4.37e-10	SMART
LDLa	1325	1362	1.66e-10	SMART
transmembrane domain	1371	1393	N/A	INTRINSIC
low complexity region	1429	1438	N/A	INTRINSIC
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1566	1573	N/A	INTRINSIC
low complexity region	1596	1608	N/A	INTRINSIC

Meta Mutation Damage Score

0.1468

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (92/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Adam3	T	A	8: 24,687,980	N639I	possibly damaging	Het
Adamtsl3	T	A	7: 82,556,874	C756S	probably damaging	Het
AI314180	A	T	4: 58,809,415	V1653D	possibly damaging	Het
Arhgap31	C	T	16: 38,712,514		probably null	Het
Ascl4	G	A	10: 85,928,665	A59T	possibly damaging	Het
Ash1l	T	A	3: 88,981,759	I315N	possibly damaging	Het
Atp6v0d2	T	C	4: 19,887,330	D206G	possibly damaging	Het
Baz1b	T	A	5: 135,223,116	L923I	probably damaging	Het
BC067074	G	T	13: 113,318,172	G251C		Het
Birc6	T	A	17: 74,612,074	N1966K	probably damaging	Het
Bod1l	T	C	5: 41,788,857	N3025S	probably benign	Het
Bub1b	C	A	2: 118,636,786	H863Q	possibly damaging	Het
C1rb	T	A	6: 124,577,452	Y397*	probably null	Het
Ccdc180	A	G	4: 45,898,644	E164G	possibly damaging	Het
Ccdc9	C	T	7: 16,280,627	V230M	probably damaging	Het
Cchcr1	C	A	17: 35,526,713	N437K	probably benign	Het
Cdhr2	T	A	13: 54,719,492	L408Q	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Chd1	T	C	17: 15,770,237	S1684P	probably damaging	Het
CN725425	A	G	15: 91,242,670	Y221C	possibly damaging	Het
Col4a2	T	C	8: 11,398,678	V66A	probably damaging	Het
Cpd	C	A	11: 76,846,953	R5L	unknown	Het
Cpeb4	C	T	11: 31,918,807	T422I	possibly damaging	Het
Cyp1a1	G	T	9: 57,700,824	R245L	probably damaging	Het
Cyp4f39	A	G	17: 32,486,954	T340A	probably damaging	Het
Cyp4v3	A	T	8: 45,321,750	F122L	probably benign	Het
Drc1	T	A	5: 30,364,468	L728Q	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Ermp1	T	A	19: 29,646,254	H112L	probably benign	Het
Exoc8	T	C	8: 124,896,581	D349G	probably damaging	Het
Fam151a	T	A	4: 106,735,510	M63K	probably benign	Het
Fmo9	C	A	1: 166,676,546	G149V	probably damaging	Het
Fndc8	A	G	11: 82,898,777	T254A	possibly damaging	Het
Foxi3	G	A	6: 70,960,878	V365I	probably benign	Het
Frem2	C	T	3: 53,654,495	G864S	probably damaging	Het
Fstl5	T	A	3: 76,482,397		probably null	Het
Garnl3	T	A	2: 33,034,129	E247V	probably damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gorasp1	T	A	9: 119,937,534		probably benign	Het
Hcar2	T	C	5: 123,864,478	N321D	possibly damaging	Het
Hoxb6	G	T	11: 96,299,569	M131I	probably damaging	Het
Kif13a	A	G	13: 46,826,745	V177A	probably damaging	Het
Limch1	C	T	5: 67,034,202	T794I	probably benign	Het
Lmbrd2	A	G	15: 9,165,819	Y260C	possibly damaging	Het
Lmo7	A	G	14: 101,885,512	N379S	probably benign	Het
Lrrc14	A	T	15: 76,714,511	E449V	probably damaging	Het
Lrrc8c	T	C	5: 105,607,267	Y303H	probably damaging	Het
Mecr	T	G	4: 131,843,675	V58G	probably null	Het
Med12l	T	A	3: 59,042,403	D193E	possibly damaging	Het
Moap1	T	C	12: 102,743,179	E37G	probably damaging	Het
Mrgprb2	T	A	7: 48,552,896	Y27F	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Ndufs5	A	T	4: 123,715,951	C43*	probably null	Het
Oaz2	A	T	9: 65,688,901	D83V		Het
Olfr204	T	A	16: 59,315,149	N86I	possibly damaging	Het
Olfr329-ps	A	T	11: 58,542,707	Y269*	probably null	Het
Palm	A	G	10: 79,816,863	T191A	probably damaging	Het
Pclo	C	A	5: 14,675,836	D1569E	unknown	Het
Ppid	T	A	3: 79,600,297	D264E	probably benign	Het
Ppp1r3a	A	G	6: 14,718,750	S722P	probably damaging	Het
Ranbp2	A	G	10: 58,485,797	S2639G	possibly damaging	Het
Rbak	T	C	5: 143,176,072	T68A	probably benign	Het
Rbm15b	C	T	9: 106,885,047	G641R	probably benign	Het
Rgsl1	A	G	1: 153,793,845	I265T	probably benign	Het
Rmdn1	T	A	4: 19,586,837	Y98*	probably null	Het
Sfxn3	T	G	19: 45,049,262	N52K	probably benign	Het
Slc17a3	G	T	13: 23,846,884	G182*	probably null	Het
Slc29a3	A	T	10: 60,750,658	Y10N	probably benign	Het
Slc43a1	T	C	2: 84,862,934	Y577H	probably damaging	Het
Smarcd3	T	A	5: 24,595,437	I210F	possibly damaging	Het
Snapc4	A	T	2: 26,369,261	S626T	probably benign	Het
Sp5	T	A	2: 70,476,697	L242*	probably null	Het
Spata25	C	G	2: 164,827,662	G143A	probably damaging	Het
Spata6	T	A	4: 111,768,738	Y101*	probably null	Het
Tdp2	T	G	13: 24,832,076	S89A	probably benign	Het
Tlr6	T	C	5: 64,953,629	E645G	probably benign	Het
Tmem209	T	C	6: 30,494,795	I355V	probably benign	Het
Trappc8	A	T	18: 20,852,647	Y646N	probably damaging	Het
Tspoap1	A	G	11: 87,766,379	N399S	probably damaging	Het
Ube4b	A	G	4: 149,343,001	Y897H	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp9y	A	T	Y: 1,315,759		probably null	Het
Vmn2r1	T	C	3: 64,105,456	*913Q	probably null	Het
Vmn2r12	T	A	5: 109,086,247	T700S	possibly damaging	Het
Vmn2r12	C	T	5: 109,091,945	A251T	possibly damaging	Het
Wdr70	A	C	15: 7,924,244	F389V	possibly damaging	Het
Wdr91	A	T	6: 34,891,460	M442K	possibly damaging	Het
Ydjc	T	C	16: 17,150,898	C234R	probably benign	Het
Zfp72	A	G	13: 74,372,348	Y204H	possibly damaging	Het

Other mutations in Lrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Lrp6	APN	6	134456090	missense	probably benign	0.17
IGL00765:Lrp6	APN	6	134541854	missense	probably benign	0.02
IGL00898:Lrp6	APN	6	134479739	missense	probably damaging	0.99
IGL00916:Lrp6	APN	6	134484289	missense	probably damaging	1.00
IGL00961:Lrp6	APN	6	134507646	missense	probably damaging	0.98
IGL01620:Lrp6	APN	6	134511262	missense	probably damaging	1.00
IGL01765:Lrp6	APN	6	134456145	missense	probably damaging	0.99
IGL02066:Lrp6	APN	6	134450937	nonsense	probably null
IGL02067:Lrp6	APN	6	134480396	missense	probably damaging	0.99
IGL02169:Lrp6	APN	6	134513327	missense	probably damaging	0.96
IGL02281:Lrp6	APN	6	134457734	missense	probably benign	0.40
IGL02484:Lrp6	APN	6	134541923	missense	probably benign	0.15
IGL02724:Lrp6	APN	6	134484265	missense	probably damaging	1.00
IGL02876:Lrp6	APN	6	134456114	missense	probably benign	0.43
IGL03011:Lrp6	APN	6	134520417	missense	possibly damaging	0.80
IGL03352:Lrp6	APN	6	134479763	missense	probably damaging	1.00
Aileron	UTSW	6	134462616	missense	probably damaging	1.00
Coiled	UTSW	6	134507558	nonsense	probably null
flap	UTSW	6	134486586	missense	probably damaging	0.99
BB004:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
BB014:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
PIT4494001:Lrp6	UTSW	6	134479778	missense	probably damaging	1.00
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0201:Lrp6	UTSW	6	134450897	nonsense	probably null
R0295:Lrp6	UTSW	6	134457693	missense	probably benign	0.02
R0370:Lrp6	UTSW	6	134479766	missense	probably damaging	1.00
R0382:Lrp6	UTSW	6	134467668	missense	probably damaging	1.00
R0413:Lrp6	UTSW	6	134507624	missense	probably damaging	0.99
R0468:Lrp6	UTSW	6	134485661	missense	possibly damaging	0.94
R0492:Lrp6	UTSW	6	134480518	missense	possibly damaging	0.58
R0584:Lrp6	UTSW	6	134456076	missense	probably damaging	0.99
R0631:Lrp6	UTSW	6	134479775	missense	possibly damaging	0.95
R0738:Lrp6	UTSW	6	134542045	missense	probably benign	0.13
R0907:Lrp6	UTSW	6	134507525	missense	probably damaging	0.96
R1273:Lrp6	UTSW	6	134467507	critical splice donor site	probably null
R1548:Lrp6	UTSW	6	134459429	missense	possibly damaging	0.89
R1639:Lrp6	UTSW	6	134453566	missense	possibly damaging	0.68
R1650:Lrp6	UTSW	6	134468769	missense	probably benign	0.01
R1696:Lrp6	UTSW	6	134468723	missense	probably damaging	1.00
R1751:Lrp6	UTSW	6	134464568	missense	probably damaging	1.00
R1780:Lrp6	UTSW	6	134464451	missense	probably damaging	0.99
R2013:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2015:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2165:Lrp6	UTSW	6	134459283	missense	probably damaging	1.00
R2294:Lrp6	UTSW	6	134457742	missense	probably damaging	1.00
R2336:Lrp6	UTSW	6	134507583	missense	probably damaging	0.97
R2964:Lrp6	UTSW	6	134467526	missense	probably damaging	1.00
R3716:Lrp6	UTSW	6	134507447	missense	probably damaging	1.00
R4017:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R4370:Lrp6	UTSW	6	134506358	nonsense	probably null
R4521:Lrp6	UTSW	6	134485862	missense	probably damaging	1.00
R4573:Lrp6	UTSW	6	134470730	nonsense	probably null
R4645:Lrp6	UTSW	6	134484250	missense	probably damaging	1.00
R4661:Lrp6	UTSW	6	134511267	missense	probably benign
R4688:Lrp6	UTSW	6	134479743	missense	probably damaging	1.00
R4784:Lrp6	UTSW	6	134479539	missense	probably benign	0.06
R5236:Lrp6	UTSW	6	134511264	missense	probably damaging	1.00
R5506:Lrp6	UTSW	6	134459296	missense	probably benign	0.09
R5508:Lrp6	UTSW	6	134464516	missense	probably benign	0.31
R6001:Lrp6	UTSW	6	134464518	missense	probably benign	0.03
R6319:Lrp6	UTSW	6	134541835	missense	possibly damaging	0.46
R6537:Lrp6	UTSW	6	134480495	missense	probably benign
R6552:Lrp6	UTSW	6	134454729	missense	probably benign	0.17
R6559:Lrp6	UTSW	6	134513254	missense	probably damaging	1.00
R6575:Lrp6	UTSW	6	134541971	missense	possibly damaging	0.80
R6585:Lrp6	UTSW	6	134507558	nonsense	probably null
R6700:Lrp6	UTSW	6	134479560	missense	probably damaging	1.00
R6724:Lrp6	UTSW	6	134486541	missense	possibly damaging	0.94
R7159:Lrp6	UTSW	6	134507551	missense	probably benign
R7266:Lrp6	UTSW	6	134507401	missense	probably damaging	1.00
R7339:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7342:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7348:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7359:Lrp6	UTSW	6	134450960	nonsense	probably null
R7366:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7368:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7501:Lrp6	UTSW	6	134486508	missense	probably damaging	1.00
R7548:Lrp6	UTSW	6	134507508	missense	probably damaging	0.97
R7652:Lrp6	UTSW	6	134511245	nonsense	probably null
R7771:Lrp6	UTSW	6	134462616	missense	probably damaging	1.00
R7927:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R8717:Lrp6	UTSW	6	134457748	missense	probably benign	0.41
R8726:Lrp6	UTSW	6	134507661	nonsense	probably null
R8792:Lrp6	UTSW	6	134486586	missense	probably damaging	0.99
R8812:Lrp6	UTSW	6	134456178	missense	probably benign
R8855:Lrp6	UTSW	6	134468822	missense	probably benign	0.04
R8866:Lrp6	UTSW	6	134468822	missense	probably benign	0.04
R8994:Lrp6	UTSW	6	134541693	missense	probably benign
R9021:Lrp6	UTSW	6	134541967	missense	probably benign	0.00
R9089:Lrp6	UTSW	6	134511206	missense	probably damaging	0.97
R9154:Lrp6	UTSW	6	134541892	missense	probably damaging	1.00
R9263:Lrp6	UTSW	6	134480504	missense	probably damaging	1.00
R9287:Lrp6	UTSW	6	134506296	missense	probably benign	0.21
R9545:Lrp6	UTSW	6	134506366	missense	probably damaging	1.00
R9574:Lrp6	UTSW	6	134470699	missense	possibly damaging	0.90
Z1176:Lrp6	UTSW	6	134456157	missense	possibly damaging	0.72
Z1177:Lrp6	UTSW	6	134462541	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCTGTACAAATATCTCCAGCACC -3'
(R):5'- AGCACTGATGTCTGTGACAG -3'

Sequencing Primer
(F):5'- ACCCACCCACTTTATAATGTTAACTG -3'
(R):5'- GTGACAGTGACTATGCTCCTAGC -3'

Posted On

2019-09-13