Incidental Mutation 'R7341:Adam3'
ID569863
Institutional Source Beutler Lab
Gene Symbol Adam3
Ensembl Gene ENSMUSG00000031553
Gene Namea disintegrin and metallopeptidase domain 3 (cyritestin)
SynonymsADAM3, Taz83, Taz83, Cyrn1, tMDC
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7341 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24677225-24725852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24687980 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 639 (N639I)
Ref Sequence ENSEMBL: ENSMUSP00000033958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033958] [ENSMUST00000167431] [ENSMUST00000170318] [ENSMUST00000171438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033958
AA Change: N639I

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033958
Gene: ENSMUSG00000031553
AA Change: N639I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 3.8e-30 PFAM
Pfam:Reprolysin_5 185 361 6.8e-9 PFAM
Pfam:Reprolysin 187 384 1.6e-64 PFAM
Pfam:Reprolysin_3 211 333 1.2e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167431
SMART Domains Protein: ENSMUSP00000127479
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170318
SMART Domains Protein: ENSMUSP00000132620
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 118 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171438
AA Change: N639I

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132651
Gene: ENSMUSG00000031553
AA Change: N639I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 23 144 2.4e-22 PFAM
Pfam:Reprolysin_5 185 361 7.8e-9 PFAM
Pfam:Reprolysin 187 384 4.1e-64 PFAM
Pfam:Reprolysin_3 211 321 1e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
MGI Phenotype PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are male infertile, due to the inability of the sperm to bind to the zona pellucida. If the zona pellucida is removed sperm-egg membrane fusion happens as expected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Arhgap31 C T 16: 38,712,514 probably null Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Fstl5 T A 3: 76,482,397 probably null Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp9y A T Y: 1,315,759 probably null Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in Adam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Adam3 APN 8 24694278 missense probably damaging 1.00
IGL01792:Adam3 APN 8 24697203 missense probably benign 0.27
IGL01894:Adam3 APN 8 24687938 missense probably benign 0.33
IGL01941:Adam3 APN 8 24681446 utr 3 prime probably benign
IGL02355:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02362:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02511:Adam3 APN 8 24695176 missense probably damaging 0.98
IGL03070:Adam3 APN 8 24703784 missense probably damaging 1.00
IGL03106:Adam3 APN 8 24715119 splice site probably benign
IGL03238:Adam3 APN 8 24687965 unclassified probably null
I2288:Adam3 UTSW 8 24684661 missense probably damaging 1.00
R0511:Adam3 UTSW 8 24695315 missense probably damaging 1.00
R1103:Adam3 UTSW 8 24714271 splice site probably benign
R1104:Adam3 UTSW 8 24681529 missense probably benign 0.10
R1430:Adam3 UTSW 8 24714271 splice site probably benign
R1599:Adam3 UTSW 8 24725361 missense possibly damaging 0.50
R1663:Adam3 UTSW 8 24687933 missense probably benign 0.03
R2023:Adam3 UTSW 8 24689463 missense possibly damaging 0.93
R2278:Adam3 UTSW 8 24711384 missense probably damaging 0.99
R3033:Adam3 UTSW 8 24694211 missense probably benign 0.00
R3440:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3441:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3688:Adam3 UTSW 8 24703848 missense probably benign 0.02
R4478:Adam3 UTSW 8 24695155 missense probably benign 0.04
R4654:Adam3 UTSW 8 24703803 missense probably damaging 1.00
R4811:Adam3 UTSW 8 24711724 missense probably benign 0.10
R4910:Adam3 UTSW 8 24694305 missense probably benign 0.03
R4921:Adam3 UTSW 8 24684614 missense probably benign 0.01
R4941:Adam3 UTSW 8 24677316 unclassified probably benign
R5239:Adam3 UTSW 8 24694191 missense possibly damaging 0.62
R5771:Adam3 UTSW 8 24707411 missense probably benign 0.00
R5897:Adam3 UTSW 8 24697228 missense probably benign 0.00
R5916:Adam3 UTSW 8 24684539 critical splice donor site probably null
R5979:Adam3 UTSW 8 24677367 missense probably benign 0.03
R6168:Adam3 UTSW 8 24681614 splice site probably null
R6189:Adam3 UTSW 8 24711336 missense probably benign 0.01
R6801:Adam3 UTSW 8 24684664 missense possibly damaging 0.61
R6997:Adam3 UTSW 8 24681523 missense probably benign 0.10
R7065:Adam3 UTSW 8 24711675 critical splice donor site probably null
R7074:Adam3 UTSW 8 24694347 missense probably benign 0.01
R7151:Adam3 UTSW 8 24695255 missense probably damaging 1.00
R7208:Adam3 UTSW 8 24711401 missense probably damaging 0.98
R7528:Adam3 UTSW 8 24677263 missense unknown
R7797:Adam3 UTSW 8 24694644 missense probably damaging 1.00
R7891:Adam3 UTSW 8 24707497 critical splice acceptor site probably null
R7974:Adam3 UTSW 8 24707497 critical splice acceptor site probably null
R8064:Adam3 UTSW 8 24681550 missense probably benign 0.10
X0063:Adam3 UTSW 8 24711706 missense probably damaging 0.96
Z1088:Adam3 UTSW 8 24681431 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCTCACTTCTACACGTG -3'
(R):5'- CGGACAAGCATATTAATTGCACAAG -3'

Sequencing Primer
(F):5'- AAGTGTCAAGTCTTAGATGGCCAC -3'
(R):5'- CAAGCATATTAATTGCACAAGTATCC -3'
Posted On2019-09-13