Incidental Mutation 'R7341:Kif13a'
ID569884
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R7341 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46826745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 177 (V177A)
Ref Sequence ENSEMBL: ENSMUSP00000055304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect probably damaging
Transcript: ENSMUST00000056978
AA Change: V177A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V177A

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225591
AA Change: V114A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Bhlha9 G C 11: 76,672,579 G11R probably benign Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CAGCCTGAAGTGTGACTGAAG -3'
(R):5'- TGCTATAAAGTGGCCATTAAAGCAC -3'

Sequencing Primer
(F):5'- GTGTGACTGAAGGACACCATTCC -3'
(R):5'- GTGGCCATTAAAGCACCTTCTAATC -3'
Posted On2019-09-13