Incidental Mutation 'R7341:Zfp72'
ID 569886
Institutional Source Beutler Lab
Gene Symbol Zfp72
Ensembl Gene ENSMUSG00000069184
Gene Name zinc finger protein 72
Synonyms Zfp74
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R7341 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 74369326-74390836 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74372348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 204 (Y204H)
Ref Sequence ENSEMBL: ENSMUSP00000089063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091481] [ENSMUST00000223163]
AlphaFold Q0VFY0
Predicted Effect possibly damaging
Transcript: ENSMUST00000091481
AA Change: Y204H

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089063
Gene: ENSMUSG00000069184
AA Change: Y204H

DomainStartEndE-ValueType
KRAB 1 32 3.57e-1 SMART
ZnF_C2H2 48 70 5.42e-2 SMART
ZnF_C2H2 76 98 1.18e-2 SMART
ZnF_C2H2 104 126 2.05e-2 SMART
ZnF_C2H2 132 154 2.3e-5 SMART
ZnF_C2H2 160 181 2.45e0 SMART
ZnF_C2H2 187 209 1.92e-2 SMART
ZnF_C2H2 215 237 5.59e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 4.94e-5 SMART
ZnF_C2H2 299 321 9.08e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
ZnF_C2H2 355 377 3.16e-3 SMART
ZnF_C2H2 383 405 2.24e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223163
AA Change: Y204H

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Arhgap31 C T 16: 38,712,514 probably null Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
BC067074 G T 13: 113,318,172 G251C Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Fstl5 T A 3: 76,482,397 probably null Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp9y A T Y: 1,315,759 probably null Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Other mutations in Zfp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Zfp72 UTSW 13 74372071 missense probably damaging 1.00
R0711:Zfp72 UTSW 13 74376425 splice site probably benign
R1498:Zfp72 UTSW 13 74372617 missense probably benign 0.01
R4032:Zfp72 UTSW 13 74372330 missense possibly damaging 0.62
R4629:Zfp72 UTSW 13 74372393 missense probably damaging 1.00
R6111:Zfp72 UTSW 13 74372385 missense probably benign 0.31
R6130:Zfp72 UTSW 13 74372341 missense possibly damaging 0.75
R6277:Zfp72 UTSW 13 74372524 nonsense probably null
R6800:Zfp72 UTSW 13 74371961 missense probably benign 0.00
R6909:Zfp72 UTSW 13 74371742 missense possibly damaging 0.47
R7298:Zfp72 UTSW 13 74372394 missense possibly damaging 0.93
R7330:Zfp72 UTSW 13 74375034 missense probably damaging 0.99
R8696:Zfp72 UTSW 13 74372480 missense probably damaging 1.00
R9280:Zfp72 UTSW 13 74372684 missense probably benign 0.16
R9429:Zfp72 UTSW 13 74372584 missense probably damaging 1.00
RF014:Zfp72 UTSW 13 74375054 missense probably benign 0.17
Z1177:Zfp72 UTSW 13 74371792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACATTCGCTGCATTTGTAGG -3'
(R):5'- ATGTGAACAATGTGGCAAAGC -3'

Sequencing Primer
(F):5'- AGGGTTTCTCTCCAGTATGAATTC -3'
(R):5'- CCCTACAAATGTGAACAGTGTGGTC -3'
Posted On 2019-09-13