Incidental Mutation 'R7341:BC067074'
ID569887
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene NamecDNA sequence BC067074
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7341 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location113293159-113379711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113318172 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 251 (G251C)
Ref Sequence ENSEMBL: ENSMUSP00000119993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136755]
Predicted Effect
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: G251C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (92/92)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Adam3 T A 8: 24,687,980 N639I possibly damaging Het
Adamtsl3 T A 7: 82,556,874 C756S probably damaging Het
AI314180 A T 4: 58,809,415 V1653D possibly damaging Het
Arhgap31 C T 16: 38,712,514 probably null Het
Ascl4 G A 10: 85,928,665 A59T possibly damaging Het
Ash1l T A 3: 88,981,759 I315N possibly damaging Het
Atp6v0d2 T C 4: 19,887,330 D206G possibly damaging Het
Baz1b T A 5: 135,223,116 L923I probably damaging Het
Birc6 T A 17: 74,612,074 N1966K probably damaging Het
Bod1l T C 5: 41,788,857 N3025S probably benign Het
Bub1b C A 2: 118,636,786 H863Q possibly damaging Het
C1rb T A 6: 124,577,452 Y397* probably null Het
Ccdc180 A G 4: 45,898,644 E164G possibly damaging Het
Ccdc9 C T 7: 16,280,627 V230M probably damaging Het
Cchcr1 C A 17: 35,526,713 N437K probably benign Het
Cdhr2 T A 13: 54,719,492 L408Q probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chd1 T C 17: 15,770,237 S1684P probably damaging Het
CN725425 A G 15: 91,242,670 Y221C possibly damaging Het
Col4a2 T C 8: 11,398,678 V66A probably damaging Het
Cpd C A 11: 76,846,953 R5L unknown Het
Cpeb4 C T 11: 31,918,807 T422I possibly damaging Het
Cyp1a1 G T 9: 57,700,824 R245L probably damaging Het
Cyp4f39 A G 17: 32,486,954 T340A probably damaging Het
Cyp4v3 A T 8: 45,321,750 F122L probably benign Het
Drc1 T A 5: 30,364,468 L728Q probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Ermp1 T A 19: 29,646,254 H112L probably benign Het
Exoc8 T C 8: 124,896,581 D349G probably damaging Het
Fam151a T A 4: 106,735,510 M63K probably benign Het
Fmo9 C A 1: 166,676,546 G149V probably damaging Het
Fndc8 A G 11: 82,898,777 T254A possibly damaging Het
Foxi3 G A 6: 70,960,878 V365I probably benign Het
Frem2 C T 3: 53,654,495 G864S probably damaging Het
Fstl5 T A 3: 76,482,397 probably null Het
Garnl3 T A 2: 33,034,129 E247V probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gorasp1 T A 9: 119,937,534 probably benign Het
Hcar2 T C 5: 123,864,478 N321D possibly damaging Het
Hoxb6 G T 11: 96,299,569 M131I probably damaging Het
Kif13a A G 13: 46,826,745 V177A probably damaging Het
Limch1 C T 5: 67,034,202 T794I probably benign Het
Lmbrd2 A G 15: 9,165,819 Y260C possibly damaging Het
Lmo7 A G 14: 101,885,512 N379S probably benign Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrc14 A T 15: 76,714,511 E449V probably damaging Het
Lrrc8c T C 5: 105,607,267 Y303H probably damaging Het
Mecr T G 4: 131,843,675 V58G probably null Het
Med12l T A 3: 59,042,403 D193E possibly damaging Het
Moap1 T C 12: 102,743,179 E37G probably damaging Het
Mrgprb2 T A 7: 48,552,896 Y27F probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Ndufs5 A T 4: 123,715,951 C43* probably null Het
Oaz2 A T 9: 65,688,901 D83V Het
Olfr204 T A 16: 59,315,149 N86I possibly damaging Het
Olfr329-ps A T 11: 58,542,707 Y269* probably null Het
Palm A G 10: 79,816,863 T191A probably damaging Het
Pclo C A 5: 14,675,836 D1569E unknown Het
Ppid T A 3: 79,600,297 D264E probably benign Het
Ppp1r3a A G 6: 14,718,750 S722P probably damaging Het
Ranbp2 A G 10: 58,485,797 S2639G possibly damaging Het
Rbak T C 5: 143,176,072 T68A probably benign Het
Rbm15b C T 9: 106,885,047 G641R probably benign Het
Rgsl1 A G 1: 153,793,845 I265T probably benign Het
Rmdn1 T A 4: 19,586,837 Y98* probably null Het
Sfxn3 T G 19: 45,049,262 N52K probably benign Het
Slc17a3 G T 13: 23,846,884 G182* probably null Het
Slc29a3 A T 10: 60,750,658 Y10N probably benign Het
Slc43a1 T C 2: 84,862,934 Y577H probably damaging Het
Smarcd3 T A 5: 24,595,437 I210F possibly damaging Het
Snapc4 A T 2: 26,369,261 S626T probably benign Het
Sp5 T A 2: 70,476,697 L242* probably null Het
Spata25 C G 2: 164,827,662 G143A probably damaging Het
Spata6 T A 4: 111,768,738 Y101* probably null Het
Tdp2 T G 13: 24,832,076 S89A probably benign Het
Tlr6 T C 5: 64,953,629 E645G probably benign Het
Tmem209 T C 6: 30,494,795 I355V probably benign Het
Trappc8 A T 18: 20,852,647 Y646N probably damaging Het
Tspoap1 A G 11: 87,766,379 N399S probably damaging Het
Ube4b A G 4: 149,343,001 Y897H probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp9y A T Y: 1,315,759 probably null Het
Vmn2r1 T C 3: 64,105,456 *913Q probably null Het
Vmn2r12 T A 5: 109,086,247 T700S possibly damaging Het
Vmn2r12 C T 5: 109,091,945 A251T possibly damaging Het
Wdr70 A C 15: 7,924,244 F389V possibly damaging Het
Wdr91 A T 6: 34,891,460 M442K possibly damaging Het
Ydjc T C 16: 17,150,898 C234R probably benign Het
Zfp72 A G 13: 74,372,348 Y204H possibly damaging Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
Sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4676:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4934:BC067074 UTSW 13 113368348 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5623:BC067074 UTSW 13 113346634 missense possibly damaging 0.95
R5668:BC067074 UTSW 13 113317167 missense possibly damaging 0.55
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7019:BC067074 UTSW 13 113351750 missense probably benign 0.01
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
R7195:BC067074 UTSW 13 113367929 missense
R7213:BC067074 UTSW 13 113317941 missense
R7250:BC067074 UTSW 13 113318815 missense
R7358:BC067074 UTSW 13 113319967 missense
R7359:BC067074 UTSW 13 113342430 missense
R7396:BC067074 UTSW 13 113318990 missense
R7632:BC067074 UTSW 13 113320886 missense
R7689:BC067074 UTSW 13 113379414 missense
R7713:BC067074 UTSW 13 113346541 missense
R7892:BC067074 UTSW 13 113319606 missense
R7975:BC067074 UTSW 13 113319606 missense
R8019:BC067074 UTSW 13 113319623 missense
R8034:BC067074 UTSW 13 113342511 missense
Predicted Primers PCR Primer
(F):5'- GCGTTTAACCAGAGGGAGATC -3'
(R):5'- CATCCACCATGATGTCCACG -3'

Sequencing Primer
(F):5'- CATACCCTGGCTTTAAGAAGGTGTC -3'
(R):5'- GTGCCTCCCGGTGACTTTAAG -3'
Posted On2019-09-13