Incidental Mutation 'R7342:Cel'
ID569910
Institutional Source Beutler Lab
Gene Symbol Cel
Ensembl Gene ENSMUSG00000026818
Gene Namecarboxyl ester lipase
Synonyms1810036E18Rik, BAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location28555795-28563403 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28560637 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 125 (Y125*)
Ref Sequence ENSEMBL: ENSMUSP00000028161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028161]
Predicted Effect probably null
Transcript: ENSMUST00000028161
AA Change: Y125*
SMART Domains Protein: ENSMUSP00000028161
Gene: ENSMUSG00000026818
AA Change: Y125*

DomainStartEndE-ValueType
Pfam:COesterase 1 542 2.4e-163 PFAM
Pfam:Abhydrolase_3 121 226 8e-8 PFAM
low complexity region 568 589 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein secreted from the pancreas into the digestive tract and from the lactating mammary gland into human milk. The physiological role of this protein is in cholesterol and lipid-soluble vitamin ester hydrolysis and absorption. This encoded protein promotes large chylomicron production in the intestine. Also its presence in plasma suggests its interactions with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. In pancreatic tumoral cells, this encoded protein is thought to be sequestrated within the Golgi compartment and is probably not secreted. This gene contains a variable number of tandem repeat (VNTR) polymorphism in the coding region that may influence the function of the encoded protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced cholesteryl ester absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Cel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Cel APN 2 28559385 missense probably damaging 0.98
IGL01327:Cel APN 2 28557955 missense possibly damaging 0.61
IGL01606:Cel APN 2 28560564 missense probably benign 0.04
R0304:Cel UTSW 2 28557771 missense probably benign 0.04
R0321:Cel UTSW 2 28561148 missense probably benign 0.00
R0865:Cel UTSW 2 28560615 missense probably damaging 1.00
R1123:Cel UTSW 2 28556740 missense probably damaging 1.00
R1424:Cel UTSW 2 28559624 missense probably damaging 0.99
R1448:Cel UTSW 2 28556326 missense probably damaging 1.00
R1597:Cel UTSW 2 28560467 splice site probably benign
R1717:Cel UTSW 2 28556777 missense probably damaging 1.00
R2256:Cel UTSW 2 28561192 missense probably damaging 1.00
R3149:Cel UTSW 2 28556131 missense probably benign 0.04
R4105:Cel UTSW 2 28558027 missense probably benign 0.35
R4520:Cel UTSW 2 28557968 missense probably benign 0.08
R5135:Cel UTSW 2 28559423 missense probably benign 0.39
R5318:Cel UTSW 2 28557708 missense possibly damaging 0.77
R5323:Cel UTSW 2 28560518 missense probably damaging 1.00
R5958:Cel UTSW 2 28560945 missense probably damaging 0.97
R6803:Cel UTSW 2 28558048 missense probably benign 0.36
R6976:Cel UTSW 2 28556842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCCTGTGCATTCACTATTC -3'
(R):5'- GGTGTCGTCAAGCTCAACAG -3'

Sequencing Primer
(F):5'- TCTTACAGTCGGAGGCTCC -3'
(R):5'- GCCCTGAAATCAGCACTGAGG -3'
Posted On2019-09-13