Incidental Mutation 'R7342:Kif1b'
ID569921
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 149214090 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 1040 (Y1040D)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably benign
Transcript: ENSMUST00000055647
AA Change: Y994D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: Y994D

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060537
AA Change: Y1040D

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: Y1040D

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149237387 missense probably benign
R7829:Kif1b UTSW 4 149220990 splice site probably null
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7980:Kif1b UTSW 4 149269921 missense probably damaging 1.00
R8047:Kif1b UTSW 4 149214922 missense probably damaging 1.00
R8237:Kif1b UTSW 4 149191185 missense probably benign 0.10
R8243:Kif1b UTSW 4 149204267 missense probably benign
R8252:Kif1b UTSW 4 149273805 missense probably damaging 1.00
R8342:Kif1b UTSW 4 149222348 missense probably damaging 0.96
R8460:Kif1b UTSW 4 149187620 missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149182340 missense probably benign 0.05
R8496:Kif1b UTSW 4 149192611 nonsense probably null
R8687:Kif1b UTSW 4 149261163 nonsense probably null
R8694:Kif1b UTSW 4 149220567 missense probably damaging 0.98
R8842:Kif1b UTSW 4 149253739 missense probably damaging 0.98
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTCTGAGAAAAGGCAATGTGC -3'
(R):5'- AGCAGTTTAGACAGGCGTAG -3'

Sequencing Primer
(F):5'- TCTGAGAAAAGGCAATGTGCTAGTG -3'
(R):5'- AGCGGATTGTGTTGTTTGACGC -3'
Posted On2019-09-13