Incidental Mutation 'R7342:Clstn1'
ID569922
Institutional Source Beutler Lab
Gene Symbol Clstn1
Ensembl Gene ENSMUSG00000039953
Gene Namecalsyntenin 1
SynonymsCst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149586468-149648899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 149629430 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 190 (A190T)
Ref Sequence ENSEMBL: ENSMUSP00000036962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]
Predicted Effect probably damaging
Transcript: ENSMUST00000039144
AA Change: A190T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: A190T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105691
AA Change: A180T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: A180T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Meta Mutation Damage Score 0.1944 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Clstn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clstn1 APN 4 149635243 missense probably damaging 0.99
IGL00585:Clstn1 APN 4 149638312 missense probably benign 0.05
IGL00911:Clstn1 APN 4 149643191 splice site probably benign
IGL01394:Clstn1 APN 4 149634782 missense possibly damaging 0.87
IGL02193:Clstn1 APN 4 149645352 missense probably benign 0.03
IGL02406:Clstn1 APN 4 149627359 missense probably damaging 1.00
IGL02501:Clstn1 APN 4 149631842 missense probably damaging 1.00
IGL02641:Clstn1 APN 4 149629511 missense probably null 1.00
R0012:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0020:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0021:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0026:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0031:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0038:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0062:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0064:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0193:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0279:Clstn1 UTSW 4 149643674 missense probably damaging 1.00
R0394:Clstn1 UTSW 4 149644178 missense probably benign 0.00
R0609:Clstn1 UTSW 4 149629300 splice site probably null
R0685:Clstn1 UTSW 4 149646855 missense probably benign 0.24
R0724:Clstn1 UTSW 4 149643624 missense possibly damaging 0.84
R1016:Clstn1 UTSW 4 149646829 missense probably benign 0.21
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1622:Clstn1 UTSW 4 149629407 missense probably damaging 0.97
R1680:Clstn1 UTSW 4 149643726 missense probably benign 0.02
R3803:Clstn1 UTSW 4 149635339 missense probably damaging 0.99
R3836:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R3838:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R4923:Clstn1 UTSW 4 149645029 missense probably benign 0.07
R5024:Clstn1 UTSW 4 149635294 missense possibly damaging 0.91
R5919:Clstn1 UTSW 4 149635246 missense probably damaging 1.00
R6269:Clstn1 UTSW 4 149644067 missense probably benign 0.00
R6354:Clstn1 UTSW 4 149643216 missense probably benign 0.05
R6382:Clstn1 UTSW 4 149626120 unclassified probably null
R6573:Clstn1 UTSW 4 149643689 missense probably damaging 1.00
R7457:Clstn1 UTSW 4 149634916 missense probably benign 0.03
R7571:Clstn1 UTSW 4 149646287 missense probably benign 0.38
R7682:Clstn1 UTSW 4 149626101 missense possibly damaging 0.72
R7738:Clstn1 UTSW 4 149635354 missense probably damaging 1.00
R7803:Clstn1 UTSW 4 149631871 missense probably damaging 1.00
R7904:Clstn1 UTSW 4 149614137 missense probably benign 0.01
R7987:Clstn1 UTSW 4 149614137 missense probably benign 0.01
R8007:Clstn1 UTSW 4 149631848 missense probably damaging 1.00
X0020:Clstn1 UTSW 4 149635251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCATTGTAGAGAGCTCAC -3'
(R):5'- ACTGGAGCTAAGTGGACTGC -3'

Sequencing Primer
(F):5'- GCTTCATTGTAGAGAGCTCACAAAAC -3'
(R):5'- AGCCTGCAAGCTCCCCTC -3'
Posted On2019-09-13