Mutagenetix > Incidental Mutations

Incidental Mutation 'R7342:Tfip11'

569927

Institutional Source

Beutler Lab

Gene Symbol

Tfip11

Ensembl Gene

ENSMUSG00000029345

Gene Name

tuftelin interacting protein 11

Synonyms

Tip39

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R7342 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112326358-112338073 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 112327972 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000031288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000129528] [ENSMUST00000198238]

Predicted Effect

probably null
Transcript: ENSMUST00000031288
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:TIP_N	17	114	1.4e-30	PFAM
G_patch	148	194	3.3e-18	SMART
low complexity region	212	218	N/A	INTRINSIC
low complexity region	228	242	N/A	INTRINSIC
Pfam:GCFC	398	667	3.4e-102	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000129528
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115225
Gene: ENSMUSG00000029345
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:TIP_N	15	70	9.1e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198238

SMART Domains

Protein: ENSMUSP00000142844
Gene: ENSMUSG00000029345

Domain	Start	End	E-Value	Type
G_patch	8	54	1.9e-20	SMART
low complexity region	72	78	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the spliceosome that promotes the release of the lariat-intron during late-stage splicing through the recruitment of a pre-mRNA splicing factor called DEAH-box helicase 15. The encoded protein contains a G-patch domain, a hallmark of RNA-processing proteins, that binds DEAH-box helicase 15. This protein contains an atypical nuclear localization sequence as well as a nuclear speckle-targeting sequence, enabling it to localize to distinct speckled regions within the cell nucleus. Polymorphisms in this gene are associated with dental caries suggesting a role in amelogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	G	11: 101,417,192	T28P	probably benign	Het
Abcc1	C	A	16: 14,465,169	R1170S	probably damaging	Het
Adam8	T	C	7: 139,986,391	N568S	probably benign	Het
Arhgap17	T	C	7: 123,327,244	R65G	probably damaging	Het
Arid4b	A	C	13: 14,136,219	I136L	probably benign	Het
Ash1l	G	T	3: 88,965,997	G29V	possibly damaging	Het
Atp6v0a2	A	G	5: 124,646,736	T320A	probably damaging	Het
B4gat1	G	A	19: 5,039,658	V228M	probably benign	Het
Calcr	T	A	6: 3,691,536	H450L	probably benign	Het
Cand1	A	T	10: 119,211,787	N599K	possibly damaging	Het
Cel	A	T	2: 28,560,637	Y125*	probably null	Het
Cfi	T	A	3: 129,875,132	N602K	probably damaging	Het
Clstn1	G	A	4: 149,629,430	A190T	probably damaging	Het
Cmklr1	C	T	5: 113,614,293	V216M	probably benign	Het
Cntnap5a	A	G	1: 116,060,122	T128A	probably benign	Het
Creld2	A	G	15: 88,826,407	T342A	probably benign	Het
Ctbp2	T	C	7: 133,014,312	E298G	probably damaging	Het
Ctsh	A	T	9: 90,074,987	E307V	probably benign	Het
Cxcl10	T	A	5: 92,348,170	D36V	probably benign	Het
Dgkb	A	G	12: 38,100,433	T73A	probably benign	Het
Dnah3	T	G	7: 120,029,985	E1449A	probably damaging	Het
Dpp6	T	C	5: 27,714,554	M683T	probably benign	Het
Foxn4	C	A	5: 114,258,699	W241L	probably damaging	Het
Gif	A	T	19: 11,763,223	H407L	probably benign	Het
Gosr1	T	C	11: 76,730,207	I219V	probably benign	Het
Gtf2f2	T	C	14: 75,906,877	D179G	probably damaging	Het
Ighg2b	A	G	12: 113,306,430	Y323H		Het
Itpr2	A	T	6: 146,327,187	H1303Q	probably damaging	Het
Kif1b	A	C	4: 149,214,090	Y1040D	possibly damaging	Het
Lbr	C	T	1: 181,825,621		probably null	Het
Lrp2	A	G	2: 69,479,290	V2755A	possibly damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Lrrcc1	T	A	3: 14,554,371	C606S	probably benign	Het
Macf1	T	C	4: 123,382,124	E6217G	probably damaging	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo9b	T	C	8: 71,355,774	V1687A	probably damaging	Het
Naip2	A	T	13: 100,189,356	F15I	probably benign	Het
Neb	A	T	2: 52,281,667	S1605T	probably damaging	Het
Nuak1	T	C	10: 84,374,967	E419G	probably damaging	Het
Olfr307	G	A	7: 86,336,087	T103I	probably benign	Het
Olfr896-ps1	A	G	9: 38,292,278	Y111C	probably damaging	Het
Paip2b	T	A	6: 83,814,826	S25C	probably damaging	Het
Pgbd5	G	A	8: 124,433,970	R53C	probably benign	Het
Plin4	T	C	17: 56,104,608	T808A	probably benign	Het
Pramef6	A	T	4: 143,896,950	I218K	probably benign	Het
Prex2	A	G	1: 11,162,325	D872G	probably benign	Het
Ptf1a	A	G	2: 19,447,166	*325W	probably null	Het
Ptprg	T	C	14: 12,237,151	V1390A	possibly damaging	Het
Rhpn2	A	G	7: 35,334,346	T2A	probably damaging	Het
Rpl18a	T	C	8: 70,895,398	N214D	unknown	Het
Scp2	T	A	4: 108,091,321	Y197F	probably benign	Het
Sftpb	G	A	6: 72,309,875	R254H	probably benign	Het
Slc17a9	T	C	2: 180,736,762	L246P	probably damaging	Het
Slc38a9	G	T	13: 112,669,591		probably benign	Het
Slc4a1ap	C	T	5: 31,536,290	L523F	possibly damaging	Het
Spats2l	C	A	1: 57,885,947	T168K	possibly damaging	Het
Sstr1	A	G	12: 58,213,670	S360G	possibly damaging	Het
Taf1b	A	T	12: 24,558,344	K581*	probably null	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Ttc23l	G	A	15: 10,551,497	H48Y	probably benign	Het
Uggt2	T	A	14: 118,994,972	H1489L	possibly damaging	Het
Unc13b	T	C	4: 43,258,703	L1346P	probably damaging	Het
Vmac	T	C	17: 56,715,644	E122G	probably benign	Het
Vmn2r125	T	C	4: 156,350,843	V172A	probably damaging	Het
Zfp54	A	G	17: 21,427,752		probably benign	Het

Other mutations in Tfip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01141:Tfip11	APN	5	112329503	missense	possibly damaging	0.51
IGL02627:Tfip11	APN	5	112329813	missense	possibly damaging	0.69
R0023:Tfip11	UTSW	5	112332009	missense	possibly damaging	0.47
R0254:Tfip11	UTSW	5	112335655	missense	probably benign	0.06
R0465:Tfip11	UTSW	5	112333264	missense	probably benign	0.32
R0569:Tfip11	UTSW	5	112328094	missense	probably damaging	1.00
R1411:Tfip11	UTSW	5	112333033	missense	probably benign	0.00
R1751:Tfip11	UTSW	5	112334432	missense	probably damaging	1.00
R1767:Tfip11	UTSW	5	112334432	missense	probably damaging	1.00
R1792:Tfip11	UTSW	5	112329397	missense	possibly damaging	0.95
R2125:Tfip11	UTSW	5	112335663	missense	possibly damaging	0.46
R4781:Tfip11	UTSW	5	112333399	missense	probably damaging	0.99
R4975:Tfip11	UTSW	5	112335747	unclassified	probably benign
R5348:Tfip11	UTSW	5	112335668	missense	probably benign	0.01
R5385:Tfip11	UTSW	5	112331220	critical splice donor site	probably null
R5469:Tfip11	UTSW	5	112334325	nonsense	probably null
R6540:Tfip11	UTSW	5	112334397	splice site	probably null
R6810:Tfip11	UTSW	5	112333597	missense	probably benign	0.07
R7199:Tfip11	UTSW	5	112331178	missense	probably benign	0.16
R7352:Tfip11	UTSW	5	112333268	missense	probably benign
R7921:Tfip11	UTSW	5	112335576	missense	probably benign	0.03
R8070:Tfip11	UTSW	5	112334930	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTGGGTCTGACTTGTCTCAC -3'
(R):5'- CCAGCACACAGTACCTTTTGC -3'

Sequencing Primer
(F):5'- GACTTGTCTCACTTGTCACGGAG -3'
(R):5'- TTTGCCTCCAAAGCTGGG -3'

Posted On

2019-09-13