Incidental Mutation 'R7342:Foxn4'
ID569929
Institutional Source Beutler Lab
Gene Symbol Foxn4
Ensembl Gene ENSMUSG00000042002
Gene Nameforkhead box N4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114254164-114273807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114258699 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 241 (W241L)
Ref Sequence ENSEMBL: ENSMUSP00000047951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044790] [ENSMUST00000129530] [ENSMUST00000144050]
Predicted Effect probably damaging
Transcript: ENSMUST00000044790
AA Change: W241L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047951
Gene: ENSMUSG00000042002
AA Change: W241L

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
FH 195 287 2.15e-46 SMART
low complexity region 386 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129530
Predicted Effect probably benign
Transcript: ENSMUST00000144050
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the winged-helix/forkhead family of transcription factors, such as FOXN4, are characterized by a 110-amino acid DNA-binding domain that can fold into a variant of the helix-turn-helix motif consisting of 3 alpha helices flanked by 2 large loops or wings. These transcription factors are involved in a variety of biologic processes as key regulators in development and metabolism (Li et al., 2004 [PubMed 15363391]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and abnormal retina morphology with a total loss of horizontal cells and decreased amacrine cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Foxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02990:Foxn4 APN 5 114272989 missense probably damaging 0.98
R0001:Foxn4 UTSW 5 114260870 missense probably damaging 1.00
R0194:Foxn4 UTSW 5 114259748 critical splice donor site probably null
R0555:Foxn4 UTSW 5 114263114 missense probably damaging 1.00
R0617:Foxn4 UTSW 5 114261068 splice site probably benign
R1662:Foxn4 UTSW 5 114256894 missense probably benign
R1785:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R1786:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R2266:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2267:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2268:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2269:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2397:Foxn4 UTSW 5 114255495 missense probably damaging 1.00
R3121:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R3122:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R4579:Foxn4 UTSW 5 114256825 missense possibly damaging 0.65
R4623:Foxn4 UTSW 5 114260930 missense possibly damaging 0.64
R4749:Foxn4 UTSW 5 114255567 missense probably damaging 1.00
R5083:Foxn4 UTSW 5 114256927 missense probably damaging 1.00
R5100:Foxn4 UTSW 5 114256759 missense possibly damaging 0.87
R5661:Foxn4 UTSW 5 114272992 missense probably benign
R7015:Foxn4 UTSW 5 114256855 missense possibly damaging 0.95
R7292:Foxn4 UTSW 5 114258655 nonsense probably null
R7627:Foxn4 UTSW 5 114260434 missense possibly damaging 0.87
R7695:Foxn4 UTSW 5 114256587 missense probably damaging 1.00
R8037:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
R8038:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCAGCGAGGTCCTTTC -3'
(R):5'- TCTGAAAGCCCTGGAATTGTG -3'

Sequencing Primer
(F):5'- GCAGCGAGGTCCTTTCGTTTC -3'
(R):5'- TGGAATTGTGGCCCAACTAC -3'
Posted On2019-09-13