Incidental Mutation 'R7342:Olfr307'
ID569938
Institutional Source Beutler Lab
Gene Symbol Olfr307
Ensembl Gene ENSMUSG00000055610
Gene Nameolfactory receptor 307
SynonymsMOR219-1, GA_x6K02T2NHDJ-9772012-9772953
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86332176-86337586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86336087 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 103 (T103I)
Ref Sequence ENSEMBL: ENSMUSP00000151140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069279] [ENSMUST00000213705] [ENSMUST00000217494]
Predicted Effect probably benign
Transcript: ENSMUST00000069279
AA Change: T103I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000063538
Gene: ENSMUSG00000055610
AA Change: T103I

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:7tm_4 29 306 1.6e-42 PFAM
Pfam:7tm_1 39 288 9.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213705
AA Change: T103I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217494
AA Change: T103I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Olfr307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr307 APN 7 86336061 missense probably benign 0.00
IGL02419:Olfr307 APN 7 86335662 missense probably damaging 0.98
IGL02519:Olfr307 APN 7 86335581 missense probably benign 0.01
IGL02750:Olfr307 APN 7 86335544 missense probably damaging 1.00
R0123:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0134:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0225:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R1025:Olfr307 UTSW 7 86335905 missense probably benign 0.09
R1511:Olfr307 UTSW 7 86336345 missense possibly damaging 0.49
R1674:Olfr307 UTSW 7 86335557 missense probably damaging 1.00
R2011:Olfr307 UTSW 7 86335747 nonsense probably null
R4588:Olfr307 UTSW 7 86335644 missense probably benign 0.00
R5637:Olfr307 UTSW 7 86335604 missense probably benign 0.00
R6163:Olfr307 UTSW 7 86336384 missense possibly damaging 0.84
R6407:Olfr307 UTSW 7 86336069 missense possibly damaging 0.90
R8066:Olfr307 UTSW 7 86335806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGAAAATGTGCCAGCTGTG -3'
(R):5'- GGATATACCTGGAAGCCCTAATGAG -3'

Sequencing Primer
(F):5'- CCAGCTGTGTATATGGCTCCAAAAAG -3'
(R):5'- TGGAAGCCCTAATGAGTAACCTC -3'
Posted On2019-09-13