Incidental Mutation 'R7342:Cand1'
ID569949
Institutional Source Beutler Lab
Gene Symbol Cand1
Ensembl Gene ENSMUSG00000020114
Gene Namecullin associated and neddylation disassociated 1
SynonymsD10Ertd516e, 2310038O07Rik, 6330512O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location119199255-119240055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119211787 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 599 (N599K)
Ref Sequence ENSEMBL: ENSMUSP00000020315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020315] [ENSMUST00000126373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020315
AA Change: N599K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: N599K

DomainStartEndE-ValueType
SCOP:d1qgra_ 53 994 4e-44 SMART
Pfam:TIP120 1040 1203 1.9e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126373
SMART Domains Protein: ENSMUSP00000115234
Gene: ENSMUSG00000020114

DomainStartEndE-ValueType
Pfam:HEAT 56 86 2.1e-5 PFAM
low complexity region 124 135 N/A INTRINSIC
Pfam:HEAT_EZ 155 209 3.7e-6 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Cand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cand1 APN 10 119211135 missense probably benign 0.00
IGL00917:Cand1 APN 10 119210936 missense possibly damaging 0.87
IGL01383:Cand1 APN 10 119208167 missense probably damaging 0.96
IGL02016:Cand1 APN 10 119212568 missense probably damaging 0.98
IGL02271:Cand1 APN 10 119211721 missense probably damaging 1.00
IGL02282:Cand1 APN 10 119210709 missense probably benign 0.26
IGL02494:Cand1 APN 10 119213617 missense probably benign
IGL02527:Cand1 APN 10 119206807 missense probably damaging 1.00
IGL02675:Cand1 APN 10 119219697 missense probably damaging 0.99
IGL02796:Cand1 UTSW 10 119213638 missense probably damaging 1.00
R0114:Cand1 UTSW 10 119216522 missense probably benign
R0667:Cand1 UTSW 10 119216520 missense probably benign 0.00
R1589:Cand1 UTSW 10 119213566 missense probably damaging 0.97
R1591:Cand1 UTSW 10 119211869 missense possibly damaging 0.63
R1626:Cand1 UTSW 10 119210014 missense possibly damaging 0.46
R1771:Cand1 UTSW 10 119208306 missense probably benign 0.05
R1937:Cand1 UTSW 10 119203020 missense probably damaging 1.00
R1951:Cand1 UTSW 10 119208020 splice site probably benign
R1990:Cand1 UTSW 10 119210067 missense probably damaging 1.00
R3522:Cand1 UTSW 10 119239197 missense probably benign 0.01
R4207:Cand1 UTSW 10 119211845 missense probably damaging 1.00
R4209:Cand1 UTSW 10 119211558 missense probably benign 0.24
R4502:Cand1 UTSW 10 119216667 missense probably benign
R4791:Cand1 UTSW 10 119210702 missense probably benign 0.02
R4841:Cand1 UTSW 10 119213546 critical splice donor site probably null
R4842:Cand1 UTSW 10 119213546 critical splice donor site probably null
R5326:Cand1 UTSW 10 119212028 missense probably benign
R5606:Cand1 UTSW 10 119211454 missense possibly damaging 0.63
R5613:Cand1 UTSW 10 119215323 missense possibly damaging 0.93
R5768:Cand1 UTSW 10 119211005 missense probably benign 0.06
R5884:Cand1 UTSW 10 119213765 missense possibly damaging 0.90
R6006:Cand1 UTSW 10 119210028 missense possibly damaging 0.83
R6062:Cand1 UTSW 10 119218010 missense possibly damaging 0.89
R6734:Cand1 UTSW 10 119211992 missense possibly damaging 0.67
R6838:Cand1 UTSW 10 119210030 missense probably benign 0.21
R7058:Cand1 UTSW 10 119211754 missense probably benign 0.00
R7425:Cand1 UTSW 10 119216243 missense probably benign 0.00
R7705:Cand1 UTSW 10 119212438 critical splice donor site probably null
R7812:Cand1 UTSW 10 119217959 missense probably benign 0.04
Z1176:Cand1 UTSW 10 119239194 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCCCAGTTTCAAAGCTC -3'
(R):5'- AGAAGCCCTTCTTGTCACTCAG -3'

Sequencing Primer
(F):5'- CTCTGATTTTTCCTGAGGAATGAAGC -3'
(R):5'- GCAGCTTGTCAAAGTGATCC -3'
Posted On2019-09-13