Incidental Mutation 'R7342:Ighg2b'
ID569955
Institutional Source Beutler Lab
Gene Symbol Ighg2b
Ensembl Gene ENSMUSG00000076613
Gene Nameimmunoglobulin heavy constant gamma 2B
SynonymsIgG2b, gamma2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location113302965-113307933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113306430 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 323 (Y323H)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000100214
Gene: ENSMUSG00000076613
AA Change: Y323H

DomainStartEndE-ValueType
IGc1 22 92 6.9e-16 SMART
low complexity region 108 121 N/A INTRINSIC
IG_like 145 220 4.02e-2 SMART
IGc1 251 324 1.64e-31 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Ighg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ighg2b APN 12 113307036 missense possibly damaging 0.79
IGL01837:Ighg2b APN 12 113306445 missense unknown
IGL01973:Ighg2b APN 12 113307685 missense unknown
IGL01998:Ighg2b APN 12 113307089 missense unknown
IGL02147:Ighg2b APN 12 113306391 makesense probably null
IGL02183:Ighg2b APN 12 113307829 missense unknown
IGL03089:Ighg2b APN 12 113306678 missense probably damaging 1.00
PIT4453001:Ighg2b UTSW 12 113306872 missense unknown
R4199:Ighg2b UTSW 12 113307287 missense probably damaging 0.96
R4459:Ighg2b UTSW 12 113306958 missense unknown
R4577:Ighg2b UTSW 12 113306892 missense unknown
R4589:Ighg2b UTSW 12 113306484 missense unknown
R4807:Ighg2b UTSW 12 113304345 unclassified probably benign
R4822:Ighg2b UTSW 12 113306391 makesense probably null
R5424:Ighg2b UTSW 12 113307930 missense unknown
R5641:Ighg2b UTSW 12 113307147 missense unknown
R6297:Ighg2b UTSW 12 113306892 missense unknown
R6701:Ighg2b UTSW 12 113307079 missense unknown
R6703:Ighg2b UTSW 12 113305033 unclassified probably benign
R6880:Ighg2b UTSW 12 113307106 missense
R7505:Ighg2b UTSW 12 113304980 missense
R7908:Ighg2b UTSW 12 113306454 missense
R7989:Ighg2b UTSW 12 113306454 missense
Predicted Primers PCR Primer
(F):5'- CTATCAGCCCGTGAGCTATG -3'
(R):5'- ATGTCAGTCTCACTTGCCTG -3'

Sequencing Primer
(F):5'- TGCTCTATACCTTGGAAAGAACCAGG -3'
(R):5'- TTCAACCCTGGAGACATCAGTGTG -3'
Posted On2019-09-13