Incidental Mutation 'R7342:Naip2'
ID569957
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene NameNLR family, apoptosis inhibitory protein 2
SynonymsBirc1b, Naip2, Naip-rs6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location100144063-100202092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100189356 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 15 (F15I)
Ref Sequence ENSEMBL: ENSMUSP00000070827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
Predicted Effect probably benign
Transcript: ENSMUST00000067975
AA Change: F15I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: F15I

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117913
AA Change: F15I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: F15I

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167986
AA Change: F15I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: F15I

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Scp2 T A 4: 108,091,321 Y197F probably benign Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
R7840:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7874:Naip2 UTSW 13 100154951 missense not run
R7874:Naip2 UTSW 13 100154960 missense probably benign
R7923:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7957:Naip2 UTSW 13 100154951 missense not run
R7957:Naip2 UTSW 13 100154960 missense probably benign
R8038:Naip2 UTSW 13 100162062 missense probably benign 0.00
R8065:Naip2 UTSW 13 100189222 missense probably damaging 1.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Z1176:Naip2 UTSW 13 100161593 missense probably benign 0.02
Z1176:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100152629 missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100162865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCGTCCATGATCTGAACTTG -3'
(R):5'- AGTTTCTCAAGCAACTTCTTTCTGG -3'

Sequencing Primer
(F):5'- CGTCCATGATCTGAACTTGTCATAGG -3'
(R):5'- CTTTCACAAGTGGATGTCAGAGGTC -3'
Posted On2019-09-13