Incidental Mutation 'R7343:Ddr2'
ID569977
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Namediscoidin domain receptor family, member 2
SynonymsNtrkr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7343 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location169972307-170110762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 169982078 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 777 (W777R)
Ref Sequence ENSEMBL: ENSMUSP00000027985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000194690]
Predicted Effect probably damaging
Transcript: ENSMUST00000027985
AA Change: W777R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: W777R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170800
AA Change: W777R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: W777R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194690
AA Change: W777R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: W777R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,162,371 N426T probably benign Het
6430548M08Rik A G 8: 120,145,588 D85G probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abcg3 A T 5: 104,968,234 F245I probably benign Het
Abhd17a G T 10: 80,584,157 F231L possibly damaging Het
Adgra1 A T 7: 139,876,142 D562V probably damaging Het
Akap7 C A 10: 25,289,669 probably benign Het
Akap9 A G 5: 4,046,364 D2413G probably damaging Het
Akr1c18 A T 13: 4,137,237 C193S probably damaging Het
Aloxe3 A T 11: 69,132,743 M231L probably benign Het
Apoh A G 11: 108,395,848 T33A probably benign Het
Atp13a5 T C 16: 29,321,749 N330D probably benign Het
C1ql3 T G 2: 13,010,778 M24L probably benign Het
Cacna1d T C 14: 30,123,057 N712S probably benign Het
Cbs T C 17: 31,619,139 M379V possibly damaging Het
Ccdc167 T C 17: 29,705,543 D28G probably damaging Het
Ccp110 A T 7: 118,724,575 Q679L probably benign Het
Ccz1 A T 5: 143,998,182 L310H probably damaging Het
Cerkl A T 2: 79,428,760 D44E probably damaging Het
Cfap221 T A 1: 119,995,098 E38V possibly damaging Het
Chia1 T A 3: 106,132,015 *474R probably null Het
Clint1 C T 11: 45,883,763 T32M probably damaging Het
Clk3 A T 9: 57,760,956 F227L probably damaging Het
Col5a3 C T 9: 20,793,946 probably null Het
Cul2 T C 18: 3,426,873 I501T probably benign Het
Dag1 G A 9: 108,209,093 A283V possibly damaging Het
Deaf1 A T 7: 141,322,958 V151D probably damaging Het
Dido1 A T 2: 180,675,121 V631E possibly damaging Het
Dpp4 G A 2: 62,358,901 Q429* probably null Het
Dscaml1 A G 9: 45,752,916 R2030G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E2f8 T A 7: 48,867,965 M697L probably damaging Het
Eef2kmt C A 16: 5,247,435 G303W probably damaging Het
Eif2ak1 A G 5: 143,877,671 Y182C probably damaging Het
Epha6 G T 16: 59,960,430 A636E probably damaging Het
Fancd2 G A 6: 113,536,939 V95I probably benign Het
Fbln5 A T 12: 101,760,816 C292S probably damaging Het
Fgfr4 A G 13: 55,159,155 Y219C probably damaging Het
Frem1 T G 4: 82,994,122 K670T probably damaging Het
Fsip2 A T 2: 82,979,367 H2010L probably benign Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gbe1 A G 16: 70,361,015 T101A probably benign Het
Gm5114 T A 7: 39,408,756 I480F probably damaging Het
Gm7145 A T 1: 117,986,112 R241S probably damaging Het
Gnal G A 18: 67,135,525 V161I probably benign Het
Gtpbp1 T C 15: 79,691,042 C46R probably benign Het
Gucy2c A T 6: 136,702,748 L971Q probably damaging Het
Hsp90b1 T C 10: 86,692,183 E740G probably damaging Het
Lingo2 G A 4: 35,709,450 L177F possibly damaging Het
Mfsd6l A G 11: 68,557,048 T242A possibly damaging Het
Mmadhc C T 2: 50,291,445 R71K probably damaging Het
Mrm3 G T 11: 76,249,900 V245L probably damaging Het
Nav3 T A 10: 109,903,758 I117F probably damaging Het
Noc3l A T 19: 38,795,024 V636D probably damaging Het
Nwd1 A T 8: 72,711,782 Q1486L probably damaging Het
Olfr1205 T G 2: 88,831,846 I243R probably damaging Het
Olfr1380 A G 11: 49,564,502 T194A possibly damaging Het
Olfr139 G T 11: 74,044,900 R125S possibly damaging Het
Olfr433 A T 1: 174,042,853 K301M probably damaging Het
Olfr785 C G 10: 129,409,983 L206V possibly damaging Het
Pax9 T A 12: 56,695,862 M1K probably null Het
Pcdha1 T C 18: 36,930,649 V122A probably damaging Het
Pgpep1l A T 7: 68,237,721 S44T probably damaging Het
Pla2g3 C T 11: 3,493,022 L452F possibly damaging Het
Plbd2 G A 5: 120,493,149 R188W probably damaging Het
Ppp1r42 G A 1: 9,968,857 P346L probably benign Het
Prdm8 T A 5: 98,184,516 V92D probably damaging Het
Ripor2 C A 13: 24,701,444 S554* probably null Het
Rps19 T C 7: 24,885,146 V4A probably damaging Het
Rrm2b T A 15: 37,944,573 I159F probably benign Het
Rusc1 C A 3: 89,091,750 G242W probably damaging Het
Sarm1 A G 11: 78,497,257 S68P possibly damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Slc22a4 A G 11: 53,986,538 F509S possibly damaging Het
Slc39a12 G A 2: 14,452,000 A600T probably damaging Het
Spta1 A T 1: 174,223,349 H1798L probably damaging Het
Sulf2 T G 2: 166,077,616 D804A possibly damaging Het
Suz12 A T 11: 80,019,703 E316D probably benign Het
Tbrg4 A G 11: 6,620,065 S270P probably benign Het
Tecta T C 9: 42,337,332 T1925A probably damaging Het
Thrap3 A T 4: 126,178,430 F390I probably damaging Het
Tpr C A 1: 150,393,494 A70E unknown Het
Trpv4 G C 5: 114,636,459 P188R probably benign Het
Txlna A C 4: 129,632,160 L298R probably damaging Het
Ubr4 T C 4: 139,413,438 S1223P probably benign Het
Ucp1 A T 8: 83,295,252 T238S probably damaging Het
Ush2a A G 1: 188,415,746 S957G probably benign Het
Usp34 A G 11: 23,488,868 N3496D Het
Vmn2r50 T C 7: 10,050,350 probably null Het
Wdr54 A G 6: 83,154,939 V130A probably benign Het
Zfp692 A T 11: 58,311,505 E362V probably damaging Het
Zfp811 A G 17: 32,797,513 Y518H probably damaging Het
Zfp994 A C 17: 22,200,068 C633W probably benign Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169984427 missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169997958 missense probably benign 0.11
IGL00490:Ddr2 APN 1 170005194 missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169984581 missense probably benign
IGL01898:Ddr2 APN 1 169998156 missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169984422 missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169982099 missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169994709 missense probably benign
IGL02330:Ddr2 APN 1 169988524 missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169984945 missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169988513 missense probably benign 0.34
built UTSW 1 169997964 missense probably damaging 1.00
debulked UTSW 1 169982098 missense probably damaging 1.00
fibro UTSW 1 170004812 splice site probably benign
fingers UTSW 1 169988540 missense probably benign 0.16
Julio UTSW 1 169997929 critical splice donor site probably null
phalanges UTSW 1 170005240 nonsense probably null
revolta UTSW 1 169988520 nonsense probably null
R0574:Ddr2 UTSW 1 169981963 splice site probably benign
R0730:Ddr2 UTSW 1 169995566 missense probably benign
R0733:Ddr2 UTSW 1 170004812 splice site probably benign
R0883:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R1340:Ddr2 UTSW 1 169998084 missense probably benign
R1815:Ddr2 UTSW 1 169995601 nonsense probably null
R1921:Ddr2 UTSW 1 170004245 missense probably damaging 1.00
R1924:Ddr2 UTSW 1 169982072 missense probably benign 0.01
R2016:Ddr2 UTSW 1 169984968 missense probably damaging 1.00
R2079:Ddr2 UTSW 1 170004776 nonsense probably null
R2178:Ddr2 UTSW 1 169994682 missense probably benign 0.18
R2903:Ddr2 UTSW 1 169998161 missense probably damaging 1.00
R3051:Ddr2 UTSW 1 169988455 missense probably benign 0.01
R3971:Ddr2 UTSW 1 169988417 missense probably damaging 1.00
R4290:Ddr2 UTSW 1 169990609 missense probably benign 0.00
R4494:Ddr2 UTSW 1 169988414 missense probably damaging 1.00
R4606:Ddr2 UTSW 1 170001852 missense probably benign 0.05
R4721:Ddr2 UTSW 1 170005240 nonsense probably null
R4734:Ddr2 UTSW 1 169998088 missense probably benign 0.41
R4855:Ddr2 UTSW 1 169988497 missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 170004771 missense probably benign 0.19
R4923:Ddr2 UTSW 1 169997929 critical splice donor site probably null
R5207:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R5325:Ddr2 UTSW 1 170001837 missense probably benign 0.00
R5439:Ddr2 UTSW 1 170004729 missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169988520 nonsense probably null
R5833:Ddr2 UTSW 1 170004696 missense probably benign 0.01
R5924:Ddr2 UTSW 1 169994628 missense probably benign 0.03
R6020:Ddr2 UTSW 1 170005102 missense probably benign 0.15
R6270:Ddr2 UTSW 1 169988540 missense probably benign 0.16
R6326:Ddr2 UTSW 1 169987140 missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169987065 missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169982098 missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169998132 missense probably benign 0.01
R7011:Ddr2 UTSW 1 169982103 missense probably damaging 1.00
R7185:Ddr2 UTSW 1 169987054 missense probably damaging 1.00
R7248:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R7278:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R7366:Ddr2 UTSW 1 169997964 missense probably damaging 1.00
R7520:Ddr2 UTSW 1 169984439 missense probably damaging 1.00
R7571:Ddr2 UTSW 1 170001851 missense probably benign 0.05
R7611:Ddr2 UTSW 1 169998158 missense possibly damaging 0.73
X0004:Ddr2 UTSW 1 169987098 missense probably benign 0.10
X0027:Ddr2 UTSW 1 169982030 missense probably damaging 1.00
Z1176:Ddr2 UTSW 1 169984955 missense probably damaging 1.00
Z1176:Ddr2 UTSW 1 169998083 missense probably benign
Z1176:Ddr2 UTSW 1 169998084 missense probably benign
Z1177:Ddr2 UTSW 1 169990622 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATCCTTGAGCTGGGGTCTTC -3'
(R):5'- GGTTTCAGATGATGGTCATGGAAC -3'

Sequencing Primer
(F):5'- GGGTCTTCCTACATAGTCAGGAC -3'
(R):5'- AACATCTTCTTTGTGGGCTTGGC -3'
Posted On2019-09-13