Incidental Mutation 'R7343:Abcb11'
ID569985
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R7343 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69299867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 282 (D282N)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: D282N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: D282N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: D282N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,162,371 N426T probably benign Het
6430548M08Rik A G 8: 120,145,588 D85G probably benign Het
Abcg3 A T 5: 104,968,234 F245I probably benign Het
Abhd17a G T 10: 80,584,157 F231L possibly damaging Het
Adgra1 A T 7: 139,876,142 D562V probably damaging Het
Akap7 C A 10: 25,289,669 probably benign Het
Akap9 A G 5: 4,046,364 D2413G probably damaging Het
Akr1c18 A T 13: 4,137,237 C193S probably damaging Het
Aloxe3 A T 11: 69,132,743 M231L probably benign Het
Apoh A G 11: 108,395,848 T33A probably benign Het
Atp13a5 T C 16: 29,321,749 N330D probably benign Het
C1ql3 T G 2: 13,010,778 M24L probably benign Het
Cacna1d T C 14: 30,123,057 N712S probably benign Het
Cbs T C 17: 31,619,139 M379V possibly damaging Het
Ccdc167 T C 17: 29,705,543 D28G probably damaging Het
Ccp110 A T 7: 118,724,575 Q679L probably benign Het
Ccz1 A T 5: 143,998,182 L310H probably damaging Het
Cerkl A T 2: 79,428,760 D44E probably damaging Het
Cfap221 T A 1: 119,995,098 E38V possibly damaging Het
Chia1 T A 3: 106,132,015 *474R probably null Het
Clint1 C T 11: 45,883,763 T32M probably damaging Het
Clk3 A T 9: 57,760,956 F227L probably damaging Het
Col5a3 C T 9: 20,793,946 probably null Het
Cul2 T C 18: 3,426,873 I501T probably benign Het
Dag1 G A 9: 108,209,093 A283V possibly damaging Het
Ddr2 A T 1: 169,982,078 W777R probably damaging Het
Deaf1 A T 7: 141,322,958 V151D probably damaging Het
Dido1 A T 2: 180,675,121 V631E possibly damaging Het
Dpp4 G A 2: 62,358,901 Q429* probably null Het
Dscaml1 A G 9: 45,752,916 R2030G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E2f8 T A 7: 48,867,965 M697L probably damaging Het
Eef2kmt C A 16: 5,247,435 G303W probably damaging Het
Eif2ak1 A G 5: 143,877,671 Y182C probably damaging Het
Epha6 G T 16: 59,960,430 A636E probably damaging Het
Fancd2 G A 6: 113,536,939 V95I probably benign Het
Fbln5 A T 12: 101,760,816 C292S probably damaging Het
Fgfr4 A G 13: 55,159,155 Y219C probably damaging Het
Frem1 T G 4: 82,994,122 K670T probably damaging Het
Fsip2 A T 2: 82,979,367 H2010L probably benign Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gbe1 A G 16: 70,361,015 T101A probably benign Het
Gm5114 T A 7: 39,408,756 I480F probably damaging Het
Gm7145 A T 1: 117,986,112 R241S probably damaging Het
Gnal G A 18: 67,135,525 V161I probably benign Het
Gtpbp1 T C 15: 79,691,042 C46R probably benign Het
Gucy2c A T 6: 136,702,748 L971Q probably damaging Het
Hsp90b1 T C 10: 86,692,183 E740G probably damaging Het
Lingo2 G A 4: 35,709,450 L177F possibly damaging Het
Mfsd6l A G 11: 68,557,048 T242A possibly damaging Het
Mmadhc C T 2: 50,291,445 R71K probably damaging Het
Mrm3 G T 11: 76,249,900 V245L probably damaging Het
Nav3 T A 10: 109,903,758 I117F probably damaging Het
Noc3l A T 19: 38,795,024 V636D probably damaging Het
Nwd1 A T 8: 72,711,782 Q1486L probably damaging Het
Olfr1205 T G 2: 88,831,846 I243R probably damaging Het
Olfr1380 A G 11: 49,564,502 T194A possibly damaging Het
Olfr139 G T 11: 74,044,900 R125S possibly damaging Het
Olfr433 A T 1: 174,042,853 K301M probably damaging Het
Olfr785 C G 10: 129,409,983 L206V possibly damaging Het
Pax9 T A 12: 56,695,862 M1K probably null Het
Pcdha1 T C 18: 36,930,649 V122A probably damaging Het
Pgpep1l A T 7: 68,237,721 S44T probably damaging Het
Pla2g3 C T 11: 3,493,022 L452F possibly damaging Het
Plbd2 G A 5: 120,493,149 R188W probably damaging Het
Ppp1r42 G A 1: 9,968,857 P346L probably benign Het
Prdm8 T A 5: 98,184,516 V92D probably damaging Het
Ripor2 C A 13: 24,701,444 S554* probably null Het
Rps19 T C 7: 24,885,146 V4A probably damaging Het
Rrm2b T A 15: 37,944,573 I159F probably benign Het
Rusc1 C A 3: 89,091,750 G242W probably damaging Het
Sarm1 A G 11: 78,497,257 S68P possibly damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Slc22a4 A G 11: 53,986,538 F509S possibly damaging Het
Slc39a12 G A 2: 14,452,000 A600T probably damaging Het
Spta1 A T 1: 174,223,349 H1798L probably damaging Het
Sulf2 T G 2: 166,077,616 D804A possibly damaging Het
Suz12 A T 11: 80,019,703 E316D probably benign Het
Tbrg4 A G 11: 6,620,065 S270P probably benign Het
Tecta T C 9: 42,337,332 T1925A probably damaging Het
Thrap3 A T 4: 126,178,430 F390I probably damaging Het
Tpr C A 1: 150,393,494 A70E unknown Het
Trpv4 G C 5: 114,636,459 P188R probably benign Het
Txlna A C 4: 129,632,160 L298R probably damaging Het
Ubr4 T C 4: 139,413,438 S1223P probably benign Het
Ucp1 A T 8: 83,295,252 T238S probably damaging Het
Ush2a A G 1: 188,415,746 S957G probably benign Het
Usp34 A G 11: 23,488,868 N3496D Het
Vmn2r50 T C 7: 10,050,350 probably null Het
Wdr54 A G 6: 83,154,939 V130A probably benign Het
Zfp692 A T 11: 58,311,505 E362V probably damaging Het
Zfp811 A G 17: 32,797,513 Y518H probably damaging Het
Zfp994 A C 17: 22,200,068 C633W probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69274039 missense probably benign 0.09
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCATCAACATTTGCCAATC -3'
(R):5'- CACCCATCTTGAACCAGCTT -3'

Sequencing Primer
(F):5'- CCTGTTGCTCTAAATGACAGTGGATC -3'
(R):5'- ACCCATCTTGAACCAGCTTTTTCTC -3'
Posted On2019-09-13