Incidental Mutation 'R7343:Sulf2'
ID569989
Institutional Source Beutler Lab
Gene Symbol Sulf2
Ensembl Gene ENSMUSG00000006800
Gene Namesulfatase 2
Synonyms2010004N24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R7343 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location166073089-166155663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 166077616 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 804 (D804A)
Ref Sequence ENSEMBL: ENSMUSP00000085405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000088095] [ENSMUST00000109249] [ENSMUST00000146497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088086
AA Change: D804A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800
AA Change: D804A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088095
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109249
AA Change: D804A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800
AA Change: D804A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146497
AA Change: D804A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous disruption of this gene may lead to a partially penetrant, strain-dependent phenotype of embryonic lethality, reduced postnatal body weight, lung abnormalities, brain malformations, and reduced fertility. Mice homozygous for a hypomorphic gene-trap allele display skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,162,371 N426T probably benign Het
6430548M08Rik A G 8: 120,145,588 D85G probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abcg3 A T 5: 104,968,234 F245I probably benign Het
Abhd17a G T 10: 80,584,157 F231L possibly damaging Het
Adgra1 A T 7: 139,876,142 D562V probably damaging Het
Akap7 C A 10: 25,289,669 probably benign Het
Akap9 A G 5: 4,046,364 D2413G probably damaging Het
Akr1c18 A T 13: 4,137,237 C193S probably damaging Het
Aloxe3 A T 11: 69,132,743 M231L probably benign Het
Apoh A G 11: 108,395,848 T33A probably benign Het
Atp13a5 T C 16: 29,321,749 N330D probably benign Het
C1ql3 T G 2: 13,010,778 M24L probably benign Het
Cacna1d T C 14: 30,123,057 N712S probably benign Het
Cbs T C 17: 31,619,139 M379V possibly damaging Het
Ccdc167 T C 17: 29,705,543 D28G probably damaging Het
Ccp110 A T 7: 118,724,575 Q679L probably benign Het
Ccz1 A T 5: 143,998,182 L310H probably damaging Het
Cerkl A T 2: 79,428,760 D44E probably damaging Het
Cfap221 T A 1: 119,995,098 E38V possibly damaging Het
Chia1 T A 3: 106,132,015 *474R probably null Het
Clint1 C T 11: 45,883,763 T32M probably damaging Het
Clk3 A T 9: 57,760,956 F227L probably damaging Het
Col5a3 C T 9: 20,793,946 probably null Het
Cul2 T C 18: 3,426,873 I501T probably benign Het
Dag1 G A 9: 108,209,093 A283V possibly damaging Het
Ddr2 A T 1: 169,982,078 W777R probably damaging Het
Deaf1 A T 7: 141,322,958 V151D probably damaging Het
Dido1 A T 2: 180,675,121 V631E possibly damaging Het
Dpp4 G A 2: 62,358,901 Q429* probably null Het
Dscaml1 A G 9: 45,752,916 R2030G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E2f8 T A 7: 48,867,965 M697L probably damaging Het
Eef2kmt C A 16: 5,247,435 G303W probably damaging Het
Eif2ak1 A G 5: 143,877,671 Y182C probably damaging Het
Epha6 G T 16: 59,960,430 A636E probably damaging Het
Fancd2 G A 6: 113,536,939 V95I probably benign Het
Fbln5 A T 12: 101,760,816 C292S probably damaging Het
Fgfr4 A G 13: 55,159,155 Y219C probably damaging Het
Frem1 T G 4: 82,994,122 K670T probably damaging Het
Fsip2 A T 2: 82,979,367 H2010L probably benign Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gbe1 A G 16: 70,361,015 T101A probably benign Het
Gm5114 T A 7: 39,408,756 I480F probably damaging Het
Gm7145 A T 1: 117,986,112 R241S probably damaging Het
Gnal G A 18: 67,135,525 V161I probably benign Het
Gtpbp1 T C 15: 79,691,042 C46R probably benign Het
Gucy2c A T 6: 136,702,748 L971Q probably damaging Het
Hsp90b1 T C 10: 86,692,183 E740G probably damaging Het
Lingo2 G A 4: 35,709,450 L177F possibly damaging Het
Mfsd6l A G 11: 68,557,048 T242A possibly damaging Het
Mmadhc C T 2: 50,291,445 R71K probably damaging Het
Mrm3 G T 11: 76,249,900 V245L probably damaging Het
Nav3 T A 10: 109,903,758 I117F probably damaging Het
Noc3l A T 19: 38,795,024 V636D probably damaging Het
Nwd1 A T 8: 72,711,782 Q1486L probably damaging Het
Olfr1205 T G 2: 88,831,846 I243R probably damaging Het
Olfr1380 A G 11: 49,564,502 T194A possibly damaging Het
Olfr139 G T 11: 74,044,900 R125S possibly damaging Het
Olfr433 A T 1: 174,042,853 K301M probably damaging Het
Olfr785 C G 10: 129,409,983 L206V possibly damaging Het
Pax9 T A 12: 56,695,862 M1K probably null Het
Pcdha1 T C 18: 36,930,649 V122A probably damaging Het
Pgpep1l A T 7: 68,237,721 S44T probably damaging Het
Pla2g3 C T 11: 3,493,022 L452F possibly damaging Het
Plbd2 G A 5: 120,493,149 R188W probably damaging Het
Ppp1r42 G A 1: 9,968,857 P346L probably benign Het
Prdm8 T A 5: 98,184,516 V92D probably damaging Het
Ripor2 C A 13: 24,701,444 S554* probably null Het
Rps19 T C 7: 24,885,146 V4A probably damaging Het
Rrm2b T A 15: 37,944,573 I159F probably benign Het
Rusc1 C A 3: 89,091,750 G242W probably damaging Het
Sarm1 A G 11: 78,497,257 S68P possibly damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Slc22a4 A G 11: 53,986,538 F509S possibly damaging Het
Slc39a12 G A 2: 14,452,000 A600T probably damaging Het
Spta1 A T 1: 174,223,349 H1798L probably damaging Het
Suz12 A T 11: 80,019,703 E316D probably benign Het
Tbrg4 A G 11: 6,620,065 S270P probably benign Het
Tecta T C 9: 42,337,332 T1925A probably damaging Het
Thrap3 A T 4: 126,178,430 F390I probably damaging Het
Tpr C A 1: 150,393,494 A70E unknown Het
Trpv4 G C 5: 114,636,459 P188R probably benign Het
Txlna A C 4: 129,632,160 L298R probably damaging Het
Ubr4 T C 4: 139,413,438 S1223P probably benign Het
Ucp1 A T 8: 83,295,252 T238S probably damaging Het
Ush2a A G 1: 188,415,746 S957G probably benign Het
Usp34 A G 11: 23,488,868 N3496D Het
Vmn2r50 T C 7: 10,050,350 probably null Het
Wdr54 A G 6: 83,154,939 V130A probably benign Het
Zfp692 A T 11: 58,311,505 E362V probably damaging Het
Zfp811 A G 17: 32,797,513 Y518H probably damaging Het
Zfp994 A C 17: 22,200,068 C633W probably benign Het
Other mutations in Sulf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sulf2 APN 2 166094492 missense possibly damaging 0.48
IGL01353:Sulf2 APN 2 166087095 missense probably damaging 1.00
IGL02427:Sulf2 APN 2 166089298 missense probably damaging 0.99
IGL02602:Sulf2 APN 2 166081300 missense probably benign 0.32
IGL02681:Sulf2 APN 2 166116985 missense probably benign 0.01
IGL03047:Sulf2 APN 2 166080894 splice site probably null
PIT4468001:Sulf2 UTSW 2 166080800 missense probably benign
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0233:Sulf2 UTSW 2 166085669 splice site probably benign
R0332:Sulf2 UTSW 2 166089199 missense probably benign 0.00
R0411:Sulf2 UTSW 2 166093516 missense probably damaging 1.00
R0599:Sulf2 UTSW 2 166083879 missense possibly damaging 0.53
R0694:Sulf2 UTSW 2 166085791 missense probably damaging 1.00
R1594:Sulf2 UTSW 2 166084447 splice site probably benign
R1710:Sulf2 UTSW 2 166079072 missense probably benign
R1725:Sulf2 UTSW 2 166081361 missense probably damaging 0.96
R1737:Sulf2 UTSW 2 166082678 missense probably benign 0.01
R1775:Sulf2 UTSW 2 166079612 missense probably benign 0.07
R2001:Sulf2 UTSW 2 166080853 missense probably benign 0.05
R2570:Sulf2 UTSW 2 166085801 missense probably benign 0.21
R4052:Sulf2 UTSW 2 166094590 missense probably damaging 1.00
R4357:Sulf2 UTSW 2 166077577 missense probably benign 0.01
R4613:Sulf2 UTSW 2 166132605 missense probably damaging 1.00
R4790:Sulf2 UTSW 2 166089295 missense probably damaging 1.00
R4858:Sulf2 UTSW 2 166081604 missense probably benign 0.00
R5033:Sulf2 UTSW 2 166081622 missense probably benign 0.01
R5692:Sulf2 UTSW 2 166081506 missense probably benign 0.03
R5695:Sulf2 UTSW 2 166132758 missense probably benign 0.03
R6504:Sulf2 UTSW 2 166083921 missense probably benign 0.00
R6816:Sulf2 UTSW 2 166082754 missense probably benign
R6859:Sulf2 UTSW 2 166087119 missense probably damaging 1.00
R6873:Sulf2 UTSW 2 166089275 missense probably damaging 0.97
R7125:Sulf2 UTSW 2 166075528 nonsense probably null
R7329:Sulf2 UTSW 2 166117088 missense probably damaging 1.00
R7669:Sulf2 UTSW 2 166093596 missense possibly damaging 0.67
X0063:Sulf2 UTSW 2 166079133 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCAACTCCTGGAAGCACAG -3'
(R):5'- ACTGTGGCTCTTGCAGAAATAAAG -3'

Sequencing Primer
(F):5'- GTACCCTTCCCTGTGATTCTGG -3'
(R):5'- AAAGGTTGGGTATTGATAGTCACCCC -3'
Posted On2019-09-13