Incidental Mutation 'R7343:Akap9'
ID569998
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R7343 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4046364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2413 (D2413G)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
Predicted Effect probably damaging
Transcript: ENSMUST00000044492
AA Change: D2413G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: D2413G

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,162,371 N426T probably benign Het
6430548M08Rik A G 8: 120,145,588 D85G probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abcg3 A T 5: 104,968,234 F245I probably benign Het
Abhd17a G T 10: 80,584,157 F231L possibly damaging Het
Adgra1 A T 7: 139,876,142 D562V probably damaging Het
Akap7 C A 10: 25,289,669 probably benign Het
Akr1c18 A T 13: 4,137,237 C193S probably damaging Het
Aloxe3 A T 11: 69,132,743 M231L probably benign Het
Apoh A G 11: 108,395,848 T33A probably benign Het
Atp13a5 T C 16: 29,321,749 N330D probably benign Het
C1ql3 T G 2: 13,010,778 M24L probably benign Het
Cacna1d T C 14: 30,123,057 N712S probably benign Het
Cbs T C 17: 31,619,139 M379V possibly damaging Het
Ccdc167 T C 17: 29,705,543 D28G probably damaging Het
Ccp110 A T 7: 118,724,575 Q679L probably benign Het
Ccz1 A T 5: 143,998,182 L310H probably damaging Het
Cerkl A T 2: 79,428,760 D44E probably damaging Het
Cfap221 T A 1: 119,995,098 E38V possibly damaging Het
Chia1 T A 3: 106,132,015 *474R probably null Het
Clint1 C T 11: 45,883,763 T32M probably damaging Het
Clk3 A T 9: 57,760,956 F227L probably damaging Het
Col5a3 C T 9: 20,793,946 probably null Het
Cul2 T C 18: 3,426,873 I501T probably benign Het
Dag1 G A 9: 108,209,093 A283V possibly damaging Het
Ddr2 A T 1: 169,982,078 W777R probably damaging Het
Deaf1 A T 7: 141,322,958 V151D probably damaging Het
Dido1 A T 2: 180,675,121 V631E possibly damaging Het
Dpp4 G A 2: 62,358,901 Q429* probably null Het
Dscaml1 A G 9: 45,752,916 R2030G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E2f8 T A 7: 48,867,965 M697L probably damaging Het
Eef2kmt C A 16: 5,247,435 G303W probably damaging Het
Eif2ak1 A G 5: 143,877,671 Y182C probably damaging Het
Epha6 G T 16: 59,960,430 A636E probably damaging Het
Fancd2 G A 6: 113,536,939 V95I probably benign Het
Fbln5 A T 12: 101,760,816 C292S probably damaging Het
Fgfr4 A G 13: 55,159,155 Y219C probably damaging Het
Frem1 T G 4: 82,994,122 K670T probably damaging Het
Fsip2 A T 2: 82,979,367 H2010L probably benign Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gbe1 A G 16: 70,361,015 T101A probably benign Het
Gm5114 T A 7: 39,408,756 I480F probably damaging Het
Gm7145 A T 1: 117,986,112 R241S probably damaging Het
Gnal G A 18: 67,135,525 V161I probably benign Het
Gtpbp1 T C 15: 79,691,042 C46R probably benign Het
Gucy2c A T 6: 136,702,748 L971Q probably damaging Het
Hsp90b1 T C 10: 86,692,183 E740G probably damaging Het
Lingo2 G A 4: 35,709,450 L177F possibly damaging Het
Mfsd6l A G 11: 68,557,048 T242A possibly damaging Het
Mmadhc C T 2: 50,291,445 R71K probably damaging Het
Mrm3 G T 11: 76,249,900 V245L probably damaging Het
Nav3 T A 10: 109,903,758 I117F probably damaging Het
Noc3l A T 19: 38,795,024 V636D probably damaging Het
Nwd1 A T 8: 72,711,782 Q1486L probably damaging Het
Olfr1205 T G 2: 88,831,846 I243R probably damaging Het
Olfr1380 A G 11: 49,564,502 T194A possibly damaging Het
Olfr139 G T 11: 74,044,900 R125S possibly damaging Het
Olfr433 A T 1: 174,042,853 K301M probably damaging Het
Olfr785 C G 10: 129,409,983 L206V possibly damaging Het
Pax9 T A 12: 56,695,862 M1K probably null Het
Pcdha1 T C 18: 36,930,649 V122A probably damaging Het
Pgpep1l A T 7: 68,237,721 S44T probably damaging Het
Pla2g3 C T 11: 3,493,022 L452F possibly damaging Het
Plbd2 G A 5: 120,493,149 R188W probably damaging Het
Ppp1r42 G A 1: 9,968,857 P346L probably benign Het
Prdm8 T A 5: 98,184,516 V92D probably damaging Het
Ripor2 C A 13: 24,701,444 S554* probably null Het
Rps19 T C 7: 24,885,146 V4A probably damaging Het
Rrm2b T A 15: 37,944,573 I159F probably benign Het
Rusc1 C A 3: 89,091,750 G242W probably damaging Het
Sarm1 A G 11: 78,497,257 S68P possibly damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Slc22a4 A G 11: 53,986,538 F509S possibly damaging Het
Slc39a12 G A 2: 14,452,000 A600T probably damaging Het
Spta1 A T 1: 174,223,349 H1798L probably damaging Het
Sulf2 T G 2: 166,077,616 D804A possibly damaging Het
Suz12 A T 11: 80,019,703 E316D probably benign Het
Tbrg4 A G 11: 6,620,065 S270P probably benign Het
Tecta T C 9: 42,337,332 T1925A probably damaging Het
Thrap3 A T 4: 126,178,430 F390I probably damaging Het
Tpr C A 1: 150,393,494 A70E unknown Het
Trpv4 G C 5: 114,636,459 P188R probably benign Het
Txlna A C 4: 129,632,160 L298R probably damaging Het
Ubr4 T C 4: 139,413,438 S1223P probably benign Het
Ucp1 A T 8: 83,295,252 T238S probably damaging Het
Ush2a A G 1: 188,415,746 S957G probably benign Het
Usp34 A G 11: 23,488,868 N3496D Het
Vmn2r50 T C 7: 10,050,350 probably null Het
Wdr54 A G 6: 83,154,939 V130A probably benign Het
Zfp692 A T 11: 58,311,505 E362V probably damaging Het
Zfp811 A G 17: 32,797,513 Y518H probably damaging Het
Zfp994 A C 17: 22,200,068 C633W probably benign Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 intron probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
R8036:Akap9 UTSW 5 4070397 nonsense probably null
R8054:Akap9 UTSW 5 4038707 critical splice donor site probably null
R8116:Akap9 UTSW 5 4061183 missense probably benign 0.04
R8150:Akap9 UTSW 5 3961982 missense probably damaging 1.00
R8234:Akap9 UTSW 5 4044845 missense probably benign 0.18
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 3962251 missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4046189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGGTTTTAGAGCAACAAG -3'
(R):5'- TCTGTCTCAGACTGGGCTTG -3'

Sequencing Primer
(F):5'- ACCAGGTAATGACGCACATG -3'
(R):5'- CTCAGACTGGGCTTGCTCTTG -3'
Posted On2019-09-13