Mutagenetix > Incidental Mutation

Incidental Mutation 'R7343:Col5a3'

570020

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

045433-MU

Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R7343 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20770050-20815067 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 20793946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

probably null
Transcript: ENSMUST00000004201

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	C	6: 83,162,371	N426T	probably benign	Het
6430548M08Rik	A	G	8: 120,145,588	D85G	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Abcg3	A	T	5: 104,968,234	F245I	probably benign	Het
Abhd17a	G	T	10: 80,584,157	F231L	possibly damaging	Het
Adgra1	A	T	7: 139,876,142	D562V	probably damaging	Het
Akap7	C	A	10: 25,289,669		probably benign	Het
Akap9	A	G	5: 4,046,364	D2413G	probably damaging	Het
Akr1c18	A	T	13: 4,137,237	C193S	probably damaging	Het
Aloxe3	A	T	11: 69,132,743	M231L	probably benign	Het
Apoh	A	G	11: 108,395,848	T33A	probably benign	Het
Atp13a5	T	C	16: 29,321,749	N330D	probably benign	Het
C1ql3	T	G	2: 13,010,778	M24L	probably benign	Het
Cacna1d	T	C	14: 30,123,057	N712S	probably benign	Het
Cbs	T	C	17: 31,619,139	M379V	possibly damaging	Het
Ccdc167	T	C	17: 29,705,543	D28G	probably damaging	Het
Ccp110	A	T	7: 118,724,575	Q679L	probably benign	Het
Ccz1	A	T	5: 143,998,182	L310H	probably damaging	Het
Cerkl	A	T	2: 79,428,760	D44E	probably damaging	Het
Cfap221	T	A	1: 119,995,098	E38V	possibly damaging	Het
Chia1	T	A	3: 106,132,015	*474R	probably null	Het
Clint1	C	T	11: 45,883,763	T32M	probably damaging	Het
Clk3	A	T	9: 57,760,956	F227L	probably damaging	Het
Cul2	T	C	18: 3,426,873	I501T	probably benign	Het
Dag1	G	A	9: 108,209,093	A283V	possibly damaging	Het
Ddr2	A	T	1: 169,982,078	W777R	probably damaging	Het
Deaf1	A	T	7: 141,322,958	V151D	probably damaging	Het
Dido1	A	T	2: 180,675,121	V631E	possibly damaging	Het
Dpp4	G	A	2: 62,358,901	Q429*	probably null	Het
Dscaml1	A	G	9: 45,752,916	R2030G	probably benign	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E2f8	T	A	7: 48,867,965	M697L	probably damaging	Het
Eef2kmt	C	A	16: 5,247,435	G303W	probably damaging	Het
Eif2ak1	A	G	5: 143,877,671	Y182C	probably damaging	Het
Epha6	G	T	16: 59,960,430	A636E	probably damaging	Het
Fancd2	G	A	6: 113,536,939	V95I	probably benign	Het
Fbln5	A	T	12: 101,760,816	C292S	probably damaging	Het
Fgfr4	A	G	13: 55,159,155	Y219C	probably damaging	Het
Frem1	T	G	4: 82,994,122	K670T	probably damaging	Het
Fsip2	A	T	2: 82,979,367	H2010L	probably benign	Het
Gas2l2	A	T	11: 83,421,990	L832*	probably null	Het
Gbe1	A	G	16: 70,361,015	T101A	probably benign	Het
Gm5114	T	A	7: 39,408,756	I480F	probably damaging	Het
Gm7145	A	T	1: 117,986,112	R241S	probably damaging	Het
Gnal	G	A	18: 67,135,525	V161I	probably benign	Het
Gtpbp1	T	C	15: 79,691,042	C46R	probably benign	Het
Gucy2c	A	T	6: 136,702,748	L971Q	probably damaging	Het
Hsp90b1	T	C	10: 86,692,183	E740G	probably damaging	Het
Lingo2	G	A	4: 35,709,450	L177F	possibly damaging	Het
Mfsd6l	A	G	11: 68,557,048	T242A	possibly damaging	Het
Mmadhc	C	T	2: 50,291,445	R71K	probably damaging	Het
Mrm3	G	T	11: 76,249,900	V245L	probably damaging	Het
Nav3	T	A	10: 109,903,758	I117F	probably damaging	Het
Noc3l	A	T	19: 38,795,024	V636D	probably damaging	Het
Nwd1	A	T	8: 72,711,782	Q1486L	probably damaging	Het
Olfr1205	T	G	2: 88,831,846	I243R	probably damaging	Het
Olfr1380	A	G	11: 49,564,502	T194A	possibly damaging	Het
Olfr139	G	T	11: 74,044,900	R125S	possibly damaging	Het
Olfr433	A	T	1: 174,042,853	K301M	probably damaging	Het
Olfr785	C	G	10: 129,409,983	L206V	possibly damaging	Het
Pax9	T	A	12: 56,695,862	M1K	probably null	Het
Pcdha1	T	C	18: 36,930,649	V122A	probably damaging	Het
Pgpep1l	A	T	7: 68,237,721	S44T	probably damaging	Het
Pla2g3	C	T	11: 3,493,022	L452F	possibly damaging	Het
Plbd2	G	A	5: 120,493,149	R188W	probably damaging	Het
Ppp1r42	G	A	1: 9,968,857	P346L	probably benign	Het
Prdm8	T	A	5: 98,184,516	V92D	probably damaging	Het
Ripor2	C	A	13: 24,701,444	S554*	probably null	Het
Rps19	T	C	7: 24,885,146	V4A	probably damaging	Het
Rrm2b	T	A	15: 37,944,573	I159F	probably benign	Het
Rusc1	C	A	3: 89,091,750	G242W	probably damaging	Het
Sarm1	A	G	11: 78,497,257	S68P	possibly damaging	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Slc22a4	A	G	11: 53,986,538	F509S	possibly damaging	Het
Slc39a12	G	A	2: 14,452,000	A600T	probably damaging	Het
Spta1	A	T	1: 174,223,349	H1798L	probably damaging	Het
Sulf2	T	G	2: 166,077,616	D804A	possibly damaging	Het
Suz12	A	T	11: 80,019,703	E316D	probably benign	Het
Tbrg4	A	G	11: 6,620,065	S270P	probably benign	Het
Tecta	T	C	9: 42,337,332	T1925A	probably damaging	Het
Thrap3	A	T	4: 126,178,430	F390I	probably damaging	Het
Tpr	C	A	1: 150,393,494	A70E	unknown	Het
Trpv4	G	C	5: 114,636,459	P188R	probably benign	Het
Txlna	A	C	4: 129,632,160	L298R	probably damaging	Het
Ubr4	T	C	4: 139,413,438	S1223P	probably benign	Het
Ucp1	A	T	8: 83,295,252	T238S	probably damaging	Het
Ush2a	A	G	1: 188,415,746	S957G	probably benign	Het
Usp34	A	G	11: 23,488,868	N3496D		Het
Vmn2r50	T	C	7: 10,050,350		probably null	Het
Wdr54	A	G	6: 83,154,939	V130A	probably benign	Het
Zfp692	A	T	11: 58,311,505	E362V	probably damaging	Het
Zfp811	A	G	17: 32,797,513	Y518H	probably damaging	Het
Zfp994	A	C	17: 22,200,068	C633W	probably benign	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20786389	nonsense	probably null
IGL01548:Col5a3	APN	9	20803000	splice site	probably benign
IGL02164:Col5a3	APN	9	20792643	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20772154	missense	unknown
IGL02333:Col5a3	APN	9	20799306	missense	unknown
IGL02349:Col5a3	APN	9	20772361	missense	unknown
IGL02390:Col5a3	APN	9	20776996	missense	unknown
IGL02685:Col5a3	APN	9	20772205	missense	unknown
IGL02941:Col5a3	APN	9	20804666	missense	unknown
IGL03001:Col5a3	APN	9	20807744	missense	unknown
IGL03061:Col5a3	APN	9	20797572	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20804635	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20808379	missense	unknown
IGL03372:Col5a3	APN	9	20775328	missense	unknown
Guppy	UTSW	9	20779033	missense	probably damaging	1.00
minifish	UTSW	9	20785586	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20809856	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20777108	splice site	probably benign
R0316:Col5a3	UTSW	9	20775325	missense	unknown
R0357:Col5a3	UTSW	9	20807768	splice site	probably benign
R0360:Col5a3	UTSW	9	20772466	missense	unknown
R0483:Col5a3	UTSW	9	20782481	splice site	probably null
R0485:Col5a3	UTSW	9	20782708	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20775485	missense	unknown
R1035:Col5a3	UTSW	9	20793499	splice site	probably benign
R1051:Col5a3	UTSW	9	20775235	missense	unknown
R1295:Col5a3	UTSW	9	20808418	missense	unknown
R1438:Col5a3	UTSW	9	20779957	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20772220	missense	unknown
R1668:Col5a3	UTSW	9	20771096	missense	unknown
R1680:Col5a3	UTSW	9	20784668	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20809777	missense	unknown
R2149:Col5a3	UTSW	9	20771270	missense	unknown
R2159:Col5a3	UTSW	9	20771310	missense	unknown
R2939:Col5a3	UTSW	9	20795658	missense	unknown
R3236:Col5a3	UTSW	9	20807653	missense	unknown
R3845:Col5a3	UTSW	9	20808377	missense	unknown
R4598:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20814896	unclassified	probably benign
R4713:Col5a3	UTSW	9	20793574	missense	unknown
R4723:Col5a3	UTSW	9	20809591	missense	unknown
R5209:Col5a3	UTSW	9	20778643	intron	probably benign
R5336:Col5a3	UTSW	9	20799301	missense	unknown
R5378:Col5a3	UTSW	9	20797576	missense	unknown
R5614:Col5a3	UTSW	9	20783476	splice site	probably benign
R5775:Col5a3	UTSW	9	20801072	missense	unknown
R5895:Col5a3	UTSW	9	20772442	missense	unknown
R6048:Col5a3	UTSW	9	20807619	missense	unknown
R6265:Col5a3	UTSW	9	20793764	missense	unknown
R6372:Col5a3	UTSW	9	20785586	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20774052	missense	unknown
R6558:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20774019	missense	unknown
R6679:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20775035	missense	unknown
R6712:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20798452	missense	unknown
R7431:Col5a3	UTSW	9	20770835	makesense	probably null
R7500:Col5a3	UTSW	9	20800289	missense	unknown
R7592:Col5a3	UTSW	9	20797393	missense	unknown
R7671:Col5a3	UTSW	9	20775086	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20774051	missense	unknown
R8510:Col5a3	UTSW	9	20793732	missense	unknown
R8979:Col5a3	UTSW	9	20775301	missense	unknown
R9050:Col5a3	UTSW	9	20786395	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20799437	missense	unknown
R9072:Col5a3	UTSW	9	20771157	missense	unknown
R9341:Col5a3	UTSW	9	20793613	missense	unknown
R9343:Col5a3	UTSW	9	20793613	missense	unknown
R9529:Col5a3	UTSW	9	20774012	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20803133	missense	unknown
R9781:Col5a3	UTSW	9	20809976	missense	unknown
Z1177:Col5a3	UTSW	9	20775334	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTGAAGCCAGGAAAGCCATCC -3'
(R):5'- CTCATCTGAACATGGTGGGG -3'

Sequencing Primer
(F):5'- GAAAGCCATCCTCTCCCTGG -3'
(R):5'- AGGAGACAGGGCTGCTC -3'

Posted On

2019-09-13