Incidental Mutation 'R7343:Usp34'
ID 570032
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 045433-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R7343 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23438868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3496 (N3496D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000128559] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128559
SMART Domains Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 159 1.59e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129368
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: N3496D

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: N3477D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: N3477D

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,139,353 (GRCm39) N426T probably benign Het
6430548M08Rik A G 8: 120,872,327 (GRCm39) D85G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Abcg3 A T 5: 105,116,100 (GRCm39) F245I probably benign Het
Abhd17a G T 10: 80,419,991 (GRCm39) F231L possibly damaging Het
Adgra1 A T 7: 139,456,058 (GRCm39) D562V probably damaging Het
Akap7 C A 10: 25,165,567 (GRCm39) probably benign Het
Akap9 A G 5: 4,096,364 (GRCm39) D2413G probably damaging Het
Akr1c18 A T 13: 4,187,236 (GRCm39) C193S probably damaging Het
Aloxe3 A T 11: 69,023,569 (GRCm39) M231L probably benign Het
Apoh A G 11: 108,286,674 (GRCm39) T33A probably benign Het
Atp13a5 T C 16: 29,140,567 (GRCm39) N330D probably benign Het
C1ql3 T G 2: 13,015,589 (GRCm39) M24L probably benign Het
Cacna1d T C 14: 29,845,014 (GRCm39) N712S probably benign Het
Cbs T C 17: 31,838,113 (GRCm39) M379V possibly damaging Het
Ccdc167 T C 17: 29,924,517 (GRCm39) D28G probably damaging Het
Ccp110 A T 7: 118,323,798 (GRCm39) Q679L probably benign Het
Ccz1 A T 5: 143,935,000 (GRCm39) L310H probably damaging Het
Cerkl A T 2: 79,259,104 (GRCm39) D44E probably damaging Het
Cfap221 T A 1: 119,922,828 (GRCm39) E38V possibly damaging Het
Chia1 T A 3: 106,039,331 (GRCm39) *474R probably null Het
Clint1 C T 11: 45,774,590 (GRCm39) T32M probably damaging Het
Clk3 A T 9: 57,668,239 (GRCm39) F227L probably damaging Het
Col5a3 C T 9: 20,705,242 (GRCm39) probably null Het
Cul2 T C 18: 3,426,873 (GRCm39) I501T probably benign Het
Dag1 G A 9: 108,086,292 (GRCm39) A283V possibly damaging Het
Ddr2 A T 1: 169,809,647 (GRCm39) W777R probably damaging Het
Deaf1 A T 7: 140,902,871 (GRCm39) V151D probably damaging Het
Dido1 A T 2: 180,316,914 (GRCm39) V631E possibly damaging Het
Dpp4 G A 2: 62,189,245 (GRCm39) Q429* probably null Het
Dscaml1 A G 9: 45,664,214 (GRCm39) R2030G probably benign Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
E2f8 T A 7: 48,517,713 (GRCm39) M697L probably damaging Het
Eef2kmt C A 16: 5,065,299 (GRCm39) G303W probably damaging Het
Eif2ak1 A G 5: 143,814,489 (GRCm39) Y182C probably damaging Het
Epha6 G T 16: 59,780,793 (GRCm39) A636E probably damaging Het
Fancd2 G A 6: 113,513,900 (GRCm39) V95I probably benign Het
Fbln5 A T 12: 101,727,075 (GRCm39) C292S probably damaging Het
Fgfr4 A G 13: 55,306,968 (GRCm39) Y219C probably damaging Het
Frem1 T G 4: 82,912,359 (GRCm39) K670T probably damaging Het
Fsip2 A T 2: 82,809,711 (GRCm39) H2010L probably benign Het
Gas2l2 A T 11: 83,312,816 (GRCm39) L832* probably null Het
Gbe1 A G 16: 70,157,903 (GRCm39) T101A probably benign Het
Gm5114 T A 7: 39,058,180 (GRCm39) I480F probably damaging Het
Gm7145 A T 1: 117,913,842 (GRCm39) R241S probably damaging Het
Gnal G A 18: 67,268,596 (GRCm39) V161I probably benign Het
Gtpbp1 T C 15: 79,575,243 (GRCm39) C46R probably benign Het
Gucy2c A T 6: 136,679,746 (GRCm39) L971Q probably damaging Het
Hsp90b1 T C 10: 86,528,047 (GRCm39) E740G probably damaging Het
Lingo2 G A 4: 35,709,450 (GRCm39) L177F possibly damaging Het
Mfsd6l A G 11: 68,447,874 (GRCm39) T242A possibly damaging Het
Mmadhc C T 2: 50,181,457 (GRCm39) R71K probably damaging Het
Mrm3 G T 11: 76,140,726 (GRCm39) V245L probably damaging Het
Nav3 T A 10: 109,739,619 (GRCm39) I117F probably damaging Het
Noc3l A T 19: 38,783,468 (GRCm39) V636D probably damaging Het
Nwd1 A T 8: 73,438,410 (GRCm39) Q1486L probably damaging Het
Or10aa1 A T 1: 173,870,419 (GRCm39) K301M probably damaging Het
Or2y10 A G 11: 49,455,329 (GRCm39) T194A possibly damaging Het
Or3a10 G T 11: 73,935,726 (GRCm39) R125S possibly damaging Het
Or4c11c T G 2: 88,662,190 (GRCm39) I243R probably damaging Het
Or6c5b C G 10: 129,245,852 (GRCm39) L206V possibly damaging Het
Pax9 T A 12: 56,742,647 (GRCm39) M1K probably null Het
Pcdha1 T C 18: 37,063,702 (GRCm39) V122A probably damaging Het
Pgpep1l A T 7: 67,887,469 (GRCm39) S44T probably damaging Het
Pla2g3 C T 11: 3,443,022 (GRCm39) L452F possibly damaging Het
Plbd2 G A 5: 120,631,214 (GRCm39) R188W probably damaging Het
Ppp1r42 G A 1: 10,039,082 (GRCm39) P346L probably benign Het
Prdm8 T A 5: 98,332,375 (GRCm39) V92D probably damaging Het
Ripor2 C A 13: 24,885,427 (GRCm39) S554* probably null Het
Rps19 T C 7: 24,584,571 (GRCm39) V4A probably damaging Het
Rrm2b T A 15: 37,944,817 (GRCm39) I159F probably benign Het
Rusc1 C A 3: 88,999,057 (GRCm39) G242W probably damaging Het
Sarm1 A G 11: 78,388,083 (GRCm39) S68P possibly damaging Het
Sctr G A 1: 119,949,955 (GRCm39) R48Q probably benign Het
Slc22a4 A G 11: 53,877,364 (GRCm39) F509S possibly damaging Het
Slc39a12 G A 2: 14,456,811 (GRCm39) A600T probably damaging Het
Spta1 A T 1: 174,050,915 (GRCm39) H1798L probably damaging Het
Sulf2 T G 2: 165,919,536 (GRCm39) D804A possibly damaging Het
Suz12 A T 11: 79,910,529 (GRCm39) E316D probably benign Het
Tbrg4 A G 11: 6,570,065 (GRCm39) S270P probably benign Het
Tecta T C 9: 42,248,628 (GRCm39) T1925A probably damaging Het
Thrap3 A T 4: 126,072,223 (GRCm39) F390I probably damaging Het
Tpr C A 1: 150,269,245 (GRCm39) A70E unknown Het
Trpv4 G C 5: 114,774,520 (GRCm39) P188R probably benign Het
Txlna A C 4: 129,525,953 (GRCm39) L298R probably damaging Het
Ubr4 T C 4: 139,140,749 (GRCm39) S1223P probably benign Het
Ucp1 A T 8: 84,021,881 (GRCm39) T238S probably damaging Het
Ush2a A G 1: 188,147,943 (GRCm39) S957G probably benign Het
Vmn2r50 T C 7: 9,784,277 (GRCm39) probably null Het
Wdr54 A G 6: 83,131,921 (GRCm39) V130A probably benign Het
Zfp692 A T 11: 58,202,331 (GRCm39) E362V probably damaging Het
Zfp811 A G 17: 33,016,487 (GRCm39) Y518H probably damaging Het
Zfp994 A C 17: 22,419,049 (GRCm39) C633W probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGACAGTTGCATTGGTGAC -3'
(R):5'- AATGGCCACAACTGAGGGAC -3'

Sequencing Primer
(F):5'- CAGTTGCATTGGTGACATAAAAACAG -3'
(R):5'- ACACAGCAGCTTCAGGGTC -3'
Posted On 2019-09-13