Mutagenetix > Incidental Mutation

Incidental Mutation 'R7343:Usp34'

570032

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R7343 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23488868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 3496 (N3496D)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000128559] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020529

SMART Domains

Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	163	2.52e-57	SMART
Pfam:AHSA1	209	325	1.4e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109539

SMART Domains

Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	2	115	2.33e-38	SMART
Pfam:AHSA1	161	277	4.3e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128372

SMART Domains

Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	15	149	2.52e-57	SMART
Pfam:AHSA1	195	311	7.5e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128559

SMART Domains

Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	159	1.59e-54	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129368

SMART Domains

Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342

Domain	Start	End	E-Value	Type
Blast:Drf_GBD	2	86	1e-19	BLAST
low complexity region	231	244	N/A	INTRINSIC
coiled coil region	259	281	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: N3496D

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147157

SMART Domains

Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	138	4.15e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180046
AA Change: N3477D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: N3477D

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	C	6: 83,162,371	N426T	probably benign	Het
6430548M08Rik	A	G	8: 120,145,588	D85G	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Abcg3	A	T	5: 104,968,234	F245I	probably benign	Het
Abhd17a	G	T	10: 80,584,157	F231L	possibly damaging	Het
Adgra1	A	T	7: 139,876,142	D562V	probably damaging	Het
Akap7	C	A	10: 25,289,669		probably benign	Het
Akap9	A	G	5: 4,046,364	D2413G	probably damaging	Het
Akr1c18	A	T	13: 4,137,237	C193S	probably damaging	Het
Aloxe3	A	T	11: 69,132,743	M231L	probably benign	Het
Apoh	A	G	11: 108,395,848	T33A	probably benign	Het
Atp13a5	T	C	16: 29,321,749	N330D	probably benign	Het
C1ql3	T	G	2: 13,010,778	M24L	probably benign	Het
Cacna1d	T	C	14: 30,123,057	N712S	probably benign	Het
Cbs	T	C	17: 31,619,139	M379V	possibly damaging	Het
Ccdc167	T	C	17: 29,705,543	D28G	probably damaging	Het
Ccp110	A	T	7: 118,724,575	Q679L	probably benign	Het
Ccz1	A	T	5: 143,998,182	L310H	probably damaging	Het
Cerkl	A	T	2: 79,428,760	D44E	probably damaging	Het
Cfap221	T	A	1: 119,995,098	E38V	possibly damaging	Het
Chia1	T	A	3: 106,132,015	*474R	probably null	Het
Clint1	C	T	11: 45,883,763	T32M	probably damaging	Het
Clk3	A	T	9: 57,760,956	F227L	probably damaging	Het
Col5a3	C	T	9: 20,793,946		probably null	Het
Cul2	T	C	18: 3,426,873	I501T	probably benign	Het
Dag1	G	A	9: 108,209,093	A283V	possibly damaging	Het
Ddr2	A	T	1: 169,982,078	W777R	probably damaging	Het
Deaf1	A	T	7: 141,322,958	V151D	probably damaging	Het
Dido1	A	T	2: 180,675,121	V631E	possibly damaging	Het
Dpp4	G	A	2: 62,358,901	Q429*	probably null	Het
Dscaml1	A	G	9: 45,752,916	R2030G	probably benign	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E2f8	T	A	7: 48,867,965	M697L	probably damaging	Het
Eef2kmt	C	A	16: 5,247,435	G303W	probably damaging	Het
Eif2ak1	A	G	5: 143,877,671	Y182C	probably damaging	Het
Epha6	G	T	16: 59,960,430	A636E	probably damaging	Het
Fancd2	G	A	6: 113,536,939	V95I	probably benign	Het
Fbln5	A	T	12: 101,760,816	C292S	probably damaging	Het
Fgfr4	A	G	13: 55,159,155	Y219C	probably damaging	Het
Frem1	T	G	4: 82,994,122	K670T	probably damaging	Het
Fsip2	A	T	2: 82,979,367	H2010L	probably benign	Het
Gas2l2	A	T	11: 83,421,990	L832*	probably null	Het
Gbe1	A	G	16: 70,361,015	T101A	probably benign	Het
Gm5114	T	A	7: 39,408,756	I480F	probably damaging	Het
Gm7145	A	T	1: 117,986,112	R241S	probably damaging	Het
Gnal	G	A	18: 67,135,525	V161I	probably benign	Het
Gtpbp1	T	C	15: 79,691,042	C46R	probably benign	Het
Gucy2c	A	T	6: 136,702,748	L971Q	probably damaging	Het
Hsp90b1	T	C	10: 86,692,183	E740G	probably damaging	Het
Lingo2	G	A	4: 35,709,450	L177F	possibly damaging	Het
Mfsd6l	A	G	11: 68,557,048	T242A	possibly damaging	Het
Mmadhc	C	T	2: 50,291,445	R71K	probably damaging	Het
Mrm3	G	T	11: 76,249,900	V245L	probably damaging	Het
Nav3	T	A	10: 109,903,758	I117F	probably damaging	Het
Noc3l	A	T	19: 38,795,024	V636D	probably damaging	Het
Nwd1	A	T	8: 72,711,782	Q1486L	probably damaging	Het
Olfr1205	T	G	2: 88,831,846	I243R	probably damaging	Het
Olfr1380	A	G	11: 49,564,502	T194A	possibly damaging	Het
Olfr139	G	T	11: 74,044,900	R125S	possibly damaging	Het
Olfr433	A	T	1: 174,042,853	K301M	probably damaging	Het
Olfr785	C	G	10: 129,409,983	L206V	possibly damaging	Het
Pax9	T	A	12: 56,695,862	M1K	probably null	Het
Pcdha1	T	C	18: 36,930,649	V122A	probably damaging	Het
Pgpep1l	A	T	7: 68,237,721	S44T	probably damaging	Het
Pla2g3	C	T	11: 3,493,022	L452F	possibly damaging	Het
Plbd2	G	A	5: 120,493,149	R188W	probably damaging	Het
Ppp1r42	G	A	1: 9,968,857	P346L	probably benign	Het
Prdm8	T	A	5: 98,184,516	V92D	probably damaging	Het
Ripor2	C	A	13: 24,701,444	S554*	probably null	Het
Rps19	T	C	7: 24,885,146	V4A	probably damaging	Het
Rrm2b	T	A	15: 37,944,573	I159F	probably benign	Het
Rusc1	C	A	3: 89,091,750	G242W	probably damaging	Het
Sarm1	A	G	11: 78,497,257	S68P	possibly damaging	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Slc22a4	A	G	11: 53,986,538	F509S	possibly damaging	Het
Slc39a12	G	A	2: 14,452,000	A600T	probably damaging	Het
Spta1	A	T	1: 174,223,349	H1798L	probably damaging	Het
Sulf2	T	G	2: 166,077,616	D804A	possibly damaging	Het
Suz12	A	T	11: 80,019,703	E316D	probably benign	Het
Tbrg4	A	G	11: 6,620,065	S270P	probably benign	Het
Tecta	T	C	9: 42,337,332	T1925A	probably damaging	Het
Thrap3	A	T	4: 126,178,430	F390I	probably damaging	Het
Tpr	C	A	1: 150,393,494	A70E	unknown	Het
Trpv4	G	C	5: 114,636,459	P188R	probably benign	Het
Txlna	A	C	4: 129,632,160	L298R	probably damaging	Het
Ubr4	T	C	4: 139,413,438	S1223P	probably benign	Het
Ucp1	A	T	8: 83,295,252	T238S	probably damaging	Het
Ush2a	A	G	1: 188,415,746	S957G	probably benign	Het
Vmn2r50	T	C	7: 10,050,350		probably null	Het
Wdr54	A	G	6: 83,154,939	V130A	probably benign	Het
Zfp692	A	T	11: 58,311,505	E362V	probably damaging	Het
Zfp811	A	G	17: 32,797,513	Y518H	probably damaging	Het
Zfp994	A	C	17: 22,200,068	C633W	probably benign	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTAGACAGTTGCATTGGTGAC -3'
(R):5'- AATGGCCACAACTGAGGGAC -3'

Sequencing Primer
(F):5'- CAGTTGCATTGGTGACATAAAAACAG -3'
(R):5'- ACACAGCAGCTTCAGGGTC -3'

Posted On

2019-09-13