Incidental Mutation 'R0644:Abcg4'
ID57004
Institutional Source Beutler Lab
Gene Symbol Abcg4
Ensembl Gene ENSMUSG00000032131
Gene NameATP binding cassette subfamily G member 4
Synonyms6430517O04Rik
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0644 (G1)
Quality Score204
Status Not validated
Chromosome9
Chromosomal Location44273188-44288615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44274699 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 625 (I625N)
Ref Sequence ENSEMBL: ENSMUSP00000124647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034648] [ENSMUST00000161354] [ENSMUST00000162783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034648
AA Change: I625N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034648
Gene: ENSMUSG00000032131
AA Change: I625N

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 1.6e-49 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160323
Predicted Effect possibly damaging
Transcript: ENSMUST00000161354
AA Change: I625N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124647
Gene: ENSMUSG00000032131
AA Change: I625N

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 4.8e-47 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162783
SMART Domains Protein: ENSMUSP00000123999
Gene: ENSMUSG00000032131

DomainStartEndE-ValueType
Blast:AAA 1 37 9e-20 BLAST
SCOP:d1gcya2 33 64 1e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a report allele exhibit increased brain lathosterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Abcg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Abcg4 APN 9 44275142 splice site probably benign
IGL00585:Abcg4 APN 9 44281623 missense probably benign 0.04
IGL02016:Abcg4 APN 9 44287350 missense probably damaging 0.99
IGL02085:Abcg4 APN 9 44281557 critical splice donor site probably null
IGL02142:Abcg4 APN 9 44277717 missense probably benign 0.18
IGL02171:Abcg4 APN 9 44275009 unclassified probably benign
IGL02309:Abcg4 APN 9 44281828 missense probably benign 0.21
IGL02882:Abcg4 APN 9 44277489 nonsense probably null
R0009:Abcg4 UTSW 9 44277649 splice site probably benign
R0023:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R0481:Abcg4 UTSW 9 44279369 missense probably benign 0.07
R0513:Abcg4 UTSW 9 44281687 missense possibly damaging 0.61
R0649:Abcg4 UTSW 9 44278033 missense probably benign 0.00
R1084:Abcg4 UTSW 9 44277469 missense probably benign 0.27
R1518:Abcg4 UTSW 9 44275369 missense probably benign 0.05
R1528:Abcg4 UTSW 9 44274723 missense probably damaging 0.99
R1702:Abcg4 UTSW 9 44275073 missense probably damaging 0.99
R1932:Abcg4 UTSW 9 44279394 missense probably benign 0.16
R4477:Abcg4 UTSW 9 44275086 missense probably damaging 1.00
R4661:Abcg4 UTSW 9 44287330 missense probably damaging 1.00
R4883:Abcg4 UTSW 9 44279319 missense probably damaging 1.00
R4901:Abcg4 UTSW 9 44277657 critical splice donor site probably null
R5039:Abcg4 UTSW 9 44281566 missense probably damaging 1.00
R5209:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R5329:Abcg4 UTSW 9 44279545 missense probably benign 0.00
R5492:Abcg4 UTSW 9 44278058 missense probably benign 0.01
R5521:Abcg4 UTSW 9 44279683 unclassified probably benign
R5558:Abcg4 UTSW 9 44281408 missense probably damaging 0.99
R5625:Abcg4 UTSW 9 44278036 missense probably benign 0.42
R6318:Abcg4 UTSW 9 44275348 missense probably benign
R7060:Abcg4 UTSW 9 44275128 missense probably benign 0.13
R7129:Abcg4 UTSW 9 44279384 missense probably benign 0.03
R7431:Abcg4 UTSW 9 44274700 missense possibly damaging 0.87
R7452:Abcg4 UTSW 9 44279600 missense probably damaging 1.00
X0028:Abcg4 UTSW 9 44274634 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCAACCTCCCAGCAGTCTTTG -3'
(R):5'- TGTGCCATGTCTGATGTCTGCC -3'

Sequencing Primer
(F):5'- TGCATCAACTTGGGAAGACTC -3'
(R):5'- GATGTCTGCCCCTTGTAACC -3'
Posted On2013-07-11