Mutagenetix > Incidental Mutations

Incidental Mutation 'R7344:Mertk'

570071

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R7344 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 128771497 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 478 (H478N)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: H478N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: H478N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	A	C	11: 58,291,447	Y216S		Het
9530053A07Rik	T	C	7: 28,140,279	S506P	possibly damaging	Het
9530053A07Rik	C	T	7: 28,152,760	T1236I	possibly damaging	Het
AI314180	A	T	4: 58,824,770	D1070E	probably benign	Het
Anpep	G	T	7: 79,838,650	S477R	possibly damaging	Het
Atp7b	T	C	8: 21,997,499	D1293G	probably damaging	Het
Caprin2	A	G	6: 148,873,067	V249A	probably benign	Het
Cep41	C	T	6: 30,693,656	R5K	probably benign	Het
Cyp2c23	A	T	19: 44,021,737		probably null	Het
Dazap2	T	A	15: 100,616,943	V15E	possibly damaging	Het
Epha8	T	A	4: 136,934,538	H582L	probably benign	Het
Fam193a	A	G	5: 34,485,730	T1513A	possibly damaging	Het
Fancd2	T	C	6: 113,568,709	V901A	probably benign	Het
Fbl	T	A	7: 28,178,935	V284E	probably damaging	Het
Fbln2	A	G	6: 91,269,973	E1065G	probably damaging	Het
Fbxw16	A	G	9: 109,449,035	V25A	probably benign	Het
Gm11562	T	G	11: 99,620,369	T2P	unknown	Het
Gm17728	G	T	17: 9,422,123	G22W	probably damaging	Het
Gm30083	A	G	14: 33,999,580	Y190H	probably benign	Het
Gm6793	T	A	8: 112,014,929	D27V	probably damaging	Het
Gm7324	A	G	14: 43,714,677	D259G	probably benign	Het
Gtf2a1l	G	A	17: 88,694,103	G129D	probably damaging	Het
Ildr2	T	A	1: 166,294,597	V203E	probably damaging	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Irx5	A	G	8: 92,359,555	T89A	probably benign	Het
Itga7	A	G	10: 128,940,929	N221S	possibly damaging	Het
Lpcat2	T	C	8: 92,875,567	W259R	probably damaging	Het
Lrrc8e	C	T	8: 4,234,815	R347C	probably damaging	Het
Lyst	T	A	13: 13,706,555	D2790E	probably benign	Het
Magi2	G	A	5: 20,550,240	R604Q	probably benign	Het
Mical3	T	A	6: 121,036,544	K293*	probably null	Het
Nod2	T	C	8: 88,660,582	L168P	probably damaging	Het
Npnt	T	C	3: 132,908,339		probably null	Het
Olfr1006	A	T	2: 85,674,931	Y73*	probably null	Het
Olfr1375	T	G	11: 51,048,295	F63V	probably damaging	Het
Olfr312	A	T	11: 58,831,482	E109D	probably damaging	Het
Olfr884	T	C	9: 38,047,957	M245T	probably benign	Het
Plcd4	A	T	1: 74,554,652	D312V	probably damaging	Het
Prss58	A	G	6: 40,895,465	I208T	probably damaging	Het
Pus7l	A	G	15: 94,540,617	S116P	probably benign	Het
Rcc1l	A	T	5: 134,176,437	I93N	probably benign	Het
Rftn2	A	C	1: 55,226,152	Y36*	probably null	Het
Rp1l1	G	A	14: 64,029,620	R885Q	probably benign	Het
Rpgrip1	A	T	14: 52,140,659	D488V	probably damaging	Het
Sacs	A	G	14: 61,207,444	Y2313C	possibly damaging	Het
Scrib	T	C	15: 76,049,258	Y1332C	probably damaging	Het
Serpinb10	T	C	1: 107,540,942	V105A	probably damaging	Het
Slc35d1	A	T	4: 103,213,046		probably null	Het
Slfn3	T	C	11: 83,212,822	V173A	probably benign	Het
Smpd3	C	T	8: 106,265,193	V243M	probably damaging	Het
Stard9	A	T	2: 120,704,686	D3808V	possibly damaging	Het
Supt16	A	T	14: 52,173,571	V692D	probably damaging	Het
Tapt1	A	T	5: 44,188,657	V317E	probably damaging	Het
Vmn2r101	T	C	17: 19,611,797	I685T	probably benign	Het
Vmn2r92	A	G	17: 18,167,251	I173V	probably benign	Het
Vps54	T	C	11: 21,274,999	I165T	probably damaging	Het
Zswim4	G	A	8: 84,223,698	R628*	probably null	Het
Zzz3	T	C	3: 152,452,099	S770P	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCATGTCTCAGCGTTTCG -3'
(R):5'- TGGGCCTTAAACCAAATTCAACAG -3'

Sequencing Primer
(F):5'- ATGTCTCAGCGTTTCGTTTCC -3'
(R):5'- CAGGTAGAGCCCAATTCAGTATTTGG -3'

Posted On

2019-09-13