Incidental Mutation 'R7344:Tapt1'
ID570077
Institutional Source Beutler Lab
Gene Symbol Tapt1
Ensembl Gene ENSMUSG00000046985
Gene Nametransmembrane anterior posterior transformation 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location44175154-44226626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44188657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 317 (V317E)
Ref Sequence ENSEMBL: ENSMUSP00000062110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055128] [ENSMUST00000199374]
Predicted Effect probably damaging
Transcript: ENSMUST00000055128
AA Change: V317E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062110
Gene: ENSMUSG00000046985
AA Change: V317E

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
Pfam:DUF747 152 456 8.9e-112 PFAM
low complexity region 473 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197266
Predicted Effect probably benign
Transcript: ENSMUST00000199374
SMART Domains Protein: ENSMUSP00000143625
Gene: ENSMUSG00000046985

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein that localizes to the centrosome and/or ciliary basal body. Mutations in this gene disrupt Golgi morphology and trafficking and normal primary cilium formation and these mutations are congenitally manifested by severe undermineralization of the intra-uterine skeleton. A mutation in the mouse ortholog of this gene results in homeotic, posterior-to-anterior transformations of the axial skeleton which are similar to the phenotype of mouse homeobox C8 gene mutants. In mouse, this gene is thought to function downstream of homeobox C8 to transduce extracellular patterning information during axial skeleton development. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for an ENU mutation causing a truncation exhibit vertebral trasnformations and defects in rib attachment and the xiphoid process. Mice homozygous for a transgenic gene disruption exhibit cleft palate and possible anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Tapt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Tapt1 APN 5 44178990 missense probably damaging 1.00
IGL03011:Tapt1 APN 5 44193187 missense possibly damaging 0.58
IGL03018:Tapt1 APN 5 44204324 missense probably damaging 1.00
R0385:Tapt1 UTSW 5 44218101 splice site probably null
R0624:Tapt1 UTSW 5 44177106 missense possibly damaging 0.81
R1491:Tapt1 UTSW 5 44218102 critical splice donor site probably null
R2423:Tapt1 UTSW 5 44192453 missense probably benign 0.08
R4175:Tapt1 UTSW 5 44177105 missense probably benign 0.02
R5794:Tapt1 UTSW 5 44177134 missense probably benign 0.00
R7355:Tapt1 UTSW 5 44177117 missense probably benign
R7464:Tapt1 UTSW 5 44188688 nonsense probably null
R7491:Tapt1 UTSW 5 44188636 missense probably damaging 1.00
X0062:Tapt1 UTSW 5 44194357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCATGTGAGAGGATGATCTG -3'
(R):5'- TAGTGCCTAAAATGGAACCCC -3'

Sequencing Primer
(F):5'- GACAGGGTTTTTCTGAATAACAGCCC -3'
(R):5'- CCCATGGGTTCCAAAAATCAC -3'
Posted On2019-09-13